ID: 1015447435

View in Genome Browser
Species Human (GRCh38)
Location 6:133323738-133323760
Sequence TAGTATATCAAACCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 67}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015447435 Original CRISPR TAGTATATCAAACCTGTTAC TGG (reversed) Intronic
907201779 1:52733223-52733245 TTGTATATCAAACCTTTTATAGG + Intronic
911099469 1:94083252-94083274 TTGTATTTCAAACCTGTTCAAGG - Intronic
912219920 1:107661854-107661876 TTGTATATCTAACATGTTACAGG + Intronic
917297597 1:173538117-173538139 TCCTTTATCAAAGCTGTTACTGG - Intronic
918841140 1:189541054-189541076 TAGTATTTCAAAACTGTTTTGGG + Intergenic
919825939 1:201503203-201503225 TAGTATTTCAAAACTTCTACAGG + Intronic
923013002 1:230104000-230104022 TAGTTAATTAAACCTGATACGGG - Intronic
923301677 1:232646883-232646905 TTGGATATCAAAACTGTTAAAGG - Intergenic
1069374086 10:67776331-67776353 TAAAACATCCAACCTGTTACCGG + Intergenic
1071338965 10:84625164-84625186 GAGTATATCAACCCTGATAGAGG + Intergenic
1074029183 10:109667457-109667479 TAGTATATAAAAAATGTTAAAGG + Intergenic
1081450312 11:43164771-43164793 TAGCATATTAAACATATTACTGG - Intergenic
1087487904 11:98781537-98781559 TACTTTATAAAAACTGTTACAGG + Intergenic
1087751176 11:102009068-102009090 CAGTATAGAAAATCTGTTACAGG - Intergenic
1095093214 12:38126673-38126695 TGGTATATTAAACATATTACTGG + Intergenic
1100284144 12:93148800-93148822 GAGAATATCAAAGCTCTTACAGG - Intergenic
1106447744 13:29851271-29851293 TATTATATCAAATCTGTATCAGG + Intergenic
1111753676 13:92365324-92365346 TAGTAGATAAAAGGTGTTACGGG + Intronic
1112487426 13:99832817-99832839 TGTTATATCAAATCTGTTAAAGG + Intronic
1116331869 14:43606709-43606731 TAGTATATCAGAAATGTCACTGG - Intergenic
1120932427 14:89862376-89862398 AAATATATCAAAAGTGTTACAGG - Intronic
1125026247 15:35032416-35032438 TAGTATATCTAAAATGTTCCTGG - Intergenic
1133737644 16:8628045-8628067 TTTTTTATCTAACCTGTTACAGG + Intronic
1139648321 16:68348032-68348054 GAGGAAATCAAACCAGTTACTGG - Intronic
1141250894 16:82358213-82358235 TAGTATGTGACACCTGTGACTGG - Intergenic
1146141248 17:30369770-30369792 TAGTATATAAACCCTATTGCTGG - Intergenic
1146986954 17:37229180-37229202 TTCTATATCAAATCTGATACAGG - Intronic
1159222691 18:65485601-65485623 TAATACATCAAACATGTTACAGG - Intergenic
926053387 2:9758831-9758853 TATTAGATCAAACCGGTTTCAGG + Intergenic
929986872 2:46743156-46743178 TATTATATTCAACATGTTACAGG + Intronic
931692910 2:64850559-64850581 TTTTATATCAAACTTCTTACAGG + Intergenic
935672322 2:105566407-105566429 TCGTATATCCATCCTTTTACAGG - Intergenic
939717991 2:145609548-145609570 TAGTAAATGAAAACTGATACAGG - Intergenic
939949628 2:148454301-148454323 TGGTATATCAATCATGTTAATGG - Intronic
943229078 2:185222153-185222175 TAGAATATCAAACCAGTCAAAGG - Intergenic
947095108 2:226557724-226557746 TAGAATATCATCCATGTTACAGG - Intergenic
947331290 2:229032193-229032215 TTCTATATCAACACTGTTACAGG + Intronic
1170374237 20:15682581-15682603 TAGTATTTCAAACCAGTGAGAGG + Intronic
1178325850 21:31644942-31644964 TAGGATACCCAACCTATTACTGG - Intergenic
955772518 3:62400092-62400114 TGGTATATGAAACCTATTACAGG + Intronic
959571544 3:107889785-107889807 TAGTATATAAAAGCAATTACAGG - Intergenic
962412638 3:135154552-135154574 TAGTATATCAAACATGTGACTGG - Intronic
963579402 3:147106032-147106054 TAGTATACCAAAACTGATTCAGG - Intergenic
971530904 4:27687521-27687543 TAGACCATCAATCCTGTTACTGG - Intergenic
972949856 4:44305697-44305719 TACTATATCAATCATGTTAGTGG - Intronic
973100194 4:46258059-46258081 TAATATATCTAACCTATTCCTGG - Intronic
977818702 4:101446024-101446046 TAGTATGTACAAGCTGTTACAGG - Intronic
981216334 4:142173398-142173420 TAGGAAATGAAACCTGTTATTGG - Intronic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
982834941 4:160111745-160111767 TAGTTTATCAAACCCTTTATGGG + Intergenic
991164112 5:63541790-63541812 TAGTTTATCAAAATTATTACTGG + Intergenic
995651129 5:114369848-114369870 TAGAGTATCCAACCTGTTTCTGG + Intronic
995993422 5:118270181-118270203 TAGCACATCCAACCTGCTACAGG + Intergenic
1000750827 5:165095108-165095130 TAGTATATGACACCTATAACAGG - Intergenic
1003293520 6:4803527-4803549 TCGTCTGTCAATCCTGTTACTGG - Intronic
1003654357 6:7992099-7992121 AACAATATGAAACCTGTTACTGG + Intronic
1005090543 6:22052304-22052326 AAGTATAACAAACCTGATCCTGG - Intergenic
1009062519 6:58414703-58414725 TGGAATATTAAACATGTTACTGG - Intergenic
1009250202 6:61289267-61289289 TGGAATATTAAACATGTTACTGG - Intergenic
1010012462 6:71064623-71064645 TTGTATATCAAATTTGTTAAAGG + Intergenic
1014405506 6:121045908-121045930 TGGCATATTAAACATGTTACTGG + Intergenic
1015447435 6:133323738-133323760 TAGTATATCAAACCTGTTACTGG - Intronic
1015947085 6:138513917-138513939 CAGTGTATCAAACCTGGCACTGG - Intronic
1048747013 8:137625587-137625609 TAGTATATCATACCTTTGAAAGG + Intergenic
1051472401 9:17460312-17460334 TAGTATAGGAAAGCTGTAACAGG + Intronic
1054977943 9:71170475-71170497 TAGTAAAACAAACCTGTTGTGGG + Intronic
1058219897 9:102285680-102285702 TACTTTATCCATCCTGTTACTGG - Intergenic
1059032030 9:110708452-110708474 CAGCAAATCAAACCTGTTAGTGG - Intronic
1185959017 X:4526783-4526805 TAATATATCACACTTGATACTGG - Intergenic
1191576398 X:62711008-62711030 TGGGATATTAAACCTATTACTGG - Intergenic
1193857020 X:86615699-86615721 TGGTATATAATACCGGTTACAGG - Intronic
1195799892 X:108696235-108696257 TGGTATTTCAATTCTGTTACTGG - Intronic
1201747511 Y:17394844-17394866 TAATATATCACACTTGATACTGG - Intergenic