ID: 1015451720

View in Genome Browser
Species Human (GRCh38)
Location 6:133377079-133377101
Sequence GTCTCCTCCACTAGAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015451716_1015451720 27 Left 1015451716 6:133377029-133377051 CCACTGCTGGCATTGTATTGTTC 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1015451720 6:133377079-133377101 GTCTCCTCCACTAGAGGAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 167
1015451717_1015451720 -1 Left 1015451717 6:133377057-133377079 CCAGTTTACTTATTTCTTGTATG 0: 1
1: 0
2: 1
3: 34
4: 462
Right 1015451720 6:133377079-133377101 GTCTCCTCCACTAGAGGAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015451720 Original CRISPR GTCTCCTCCACTAGAGGAGG AGG Intronic
900422926 1:2563395-2563417 GTCTCCTCCAGTGGAGGGAGAGG + Exonic
901198813 1:7455195-7455217 GGCTCCTGCACTAGAGAAGCAGG - Intronic
901778923 1:11579806-11579828 GTCGCCTCCAGGAGGGGAGGAGG - Intergenic
904904394 1:33884107-33884129 GACTCATCCACTAGAGAGGGTGG - Intronic
905949463 1:41936510-41936532 GTCTACTCCACTTAAGAAGGTGG + Intronic
906368334 1:45230652-45230674 CACTCCTCTACCAGAGGAGGAGG + Intronic
906801990 1:48745913-48745935 GTCTCCCCTACTAAAGGAGGAGG + Intronic
907633414 1:56107352-56107374 GCCACCTGCACTAGAGCAGGTGG + Intergenic
913140539 1:115937106-115937128 TTCAGCTCCACTAGCGGAGGTGG + Intergenic
913389493 1:118294782-118294804 GCCTTCTCCACTAGAAGATGGGG + Intergenic
914684614 1:149967434-149967456 GTCTCCTCCAATGGTGGGGGTGG - Exonic
915640828 1:157224737-157224759 GTCTCCACCAGTAGAGAAGATGG - Intergenic
916694107 1:167220126-167220148 GTCTCCTGCACTAGCAGAGCCGG + Intergenic
918486654 1:185035932-185035954 ATCCTCTCCACTGGAGGAGGAGG + Intergenic
919722103 1:200849163-200849185 ATCTCCTCTACGAGAGGAAGCGG + Exonic
922285550 1:224167763-224167785 GTCTCCTCCCCTTGAGGATTAGG - Intergenic
923506398 1:234609601-234609623 GTCTCCCCCACCAGCGGCGGCGG + Intergenic
1070780657 10:79135763-79135785 GTCTCCTCCTCTATAAGATGGGG + Intronic
1076604583 10:131681211-131681233 GTCTCCTGCAGAAGTGGAGGTGG + Intergenic
1077466772 11:2737135-2737157 GACTCCCCCAGGAGAGGAGGAGG + Intronic
1077497087 11:2891615-2891637 CCCTCCTCCACTGCAGGAGGAGG + Intronic
1078633457 11:13027756-13027778 GTCTCCCCCACTAGTGGGGTGGG + Intergenic
1083726385 11:64630691-64630713 GTCTCAACCGCTGGAGGAGGTGG + Intronic
1084575629 11:69986289-69986311 GTCCCCGCCACCAGAGGTGGGGG - Intergenic
1087896160 11:103589219-103589241 GTCTCCCCCACTAGACTATGAGG - Intergenic
1091053648 11:132398163-132398185 GTCTCCTGCACTAGATAATGAGG + Intergenic
1095967655 12:47879615-47879637 GTCTCCTCCTCTTGAGGGTGGGG + Intronic
1096197249 12:49656682-49656704 TTCTCTTCCAGCAGAGGAGGGGG + Intronic
1096679079 12:53242797-53242819 GACTCTTCCTCTAGAGGAGCTGG + Intergenic
1097246165 12:57608958-57608980 GTGTCCTCCCTTAGGGGAGGTGG + Intronic
1097463163 12:59888772-59888794 GTCTCCTTCACTGCAGGCGGGGG + Intergenic
1098532353 12:71555290-71555312 TTTTCCTCCACTAGAGGAAATGG + Intronic
1100396783 12:94192788-94192810 GAATCTTCCACTAGAGTAGGTGG - Intronic
1100587736 12:95995450-95995472 TTCTCCTCCATCAGAGGTGGAGG + Intronic
1102478172 12:113202232-113202254 GGCTCCTCCACAAGAAAAGGGGG - Intronic
1109316173 13:60752635-60752657 CTCTGCTTCAATAGAGGAGGTGG + Intergenic
1111978952 13:94997002-94997024 GTGTCCTCTCCTAGAGGCGGGGG + Intergenic
1114189073 14:20427506-20427528 GTCTCACCCATTAGAGAAGGGGG - Intergenic
1114306847 14:21431195-21431217 GTCTCCTCCAGTAGTGCTGGAGG - Exonic
1114414729 14:22534159-22534181 GACTCCTCCAGTGGATGAGGGGG + Intergenic
1114489970 14:23094492-23094514 GTCTGCTCGATTAGATGAGGAGG - Intronic
1115929142 14:38471262-38471284 GTCTCCTTCAAGAGAAGAGGTGG - Intergenic
1117343029 14:54807912-54807934 CTGGCCTCCACTAGAGGAAGAGG + Intergenic
1117556023 14:56884778-56884800 GTCTTCTCAACTGGACGAGGTGG + Intergenic
1118903872 14:70009075-70009097 GTCTCCTTGGCTAGAGGAAGAGG - Intronic
1119478121 14:74942788-74942810 GTCTCCTCCTATGGAGGAGGGGG + Intronic
1119563947 14:75612864-75612886 GTCTCCTCCACTTGAGGTCTTGG + Intronic
1122850035 14:104523094-104523116 GCAGCCTCCACTAGAGGATGGGG + Intronic
1123476104 15:20593405-20593427 GTCTCCTCCAGGAGAGGTGTGGG + Intergenic
1123641908 15:22406959-22406981 GTCTCCTCCAGGAGAGGTGTGGG - Intergenic
1124021858 15:25932823-25932845 CTCTCCTCCACTGCAGGATGTGG + Intergenic
1127654864 15:61046374-61046396 GTCTCCGCCAGGAGAGGTGGTGG + Intronic
1128389978 15:67176168-67176190 GTCTCCTATGCTAGAGGATGAGG - Intronic
1128794053 15:70451969-70451991 GTCTCATCACCAAGAGGAGGTGG - Intergenic
1129348915 15:74942720-74942742 ATCTCCTCCTCTTGAGTAGGGGG - Intergenic
1129614144 15:77084550-77084572 GTTTCCTCCACCAGAGCATGGGG + Intergenic
1130602436 15:85285486-85285508 GTCTCAACCACAAGAGAAGGTGG - Intergenic
1134381509 16:13731485-13731507 AGCTCCTCCTCTTGAGGAGGAGG - Intergenic
1134552372 16:15144084-15144106 GGCTCCTCCAGGAGAGGACGGGG - Intergenic
1137040482 16:35607239-35607261 GTCTCATCCTCTGGAGGAGCTGG - Intergenic
1137751922 16:50869319-50869341 GTCTCCTCCTCAGGAGGAGGAGG - Intergenic
1138022189 16:53494804-53494826 CTCTCCTCCACTAGAGCCTGAGG + Intronic
1138385667 16:56634388-56634410 GTGTCCTCCACTATTGCAGGTGG + Intergenic
1138386218 16:56637492-56637514 GTGTCCTCCACTATTGCAGGTGG + Intergenic
1139579417 16:67863604-67863626 GCCTCCTCCACTATAAGATGGGG - Intronic
1140281201 16:73556755-73556777 ACATCCTCCACTAGAGGATGTGG + Intergenic
1142629607 17:1216294-1216316 CTCTCCTCCTCTGGAGCAGGGGG - Intronic
1143599671 17:7936279-7936301 CACTCCCCCACTAGAGGAGCTGG + Intronic
1145996721 17:29109090-29109112 TTCTCCTTCACTAGAAGAGCAGG - Intronic
1148680255 17:49469774-49469796 GTCCCCTCCTCTAGCAGAGGAGG - Intronic
1149646949 17:58247991-58248013 GTCTCTTCTACTAGAGGAAGTGG - Intronic
1150993993 17:70295067-70295089 CTCTCCTCAACTAGAGGAAAAGG - Intergenic
1152317729 17:79590619-79590641 GGCTCCTCCAGGAAAGGAGGCGG + Intergenic
1152510741 17:80785860-80785882 GTCTTCACCACTAGAGAAGGGGG + Intronic
1153716497 18:7855126-7855148 TTCTCCTCCACCAGGGGAGAAGG - Intronic
1155179468 18:23331398-23331420 GTCTCCTGTACTACAGGTGGTGG - Intronic
1155415801 18:25598003-25598025 GCCTCCTTCTCTAGAGCAGGGGG + Intergenic
1155450853 18:25961167-25961189 GTCTTCTCCTCTGGAAGAGGTGG - Intergenic
1156481732 18:37440577-37440599 GTCTCCTTCCTTGGAGGAGGTGG + Intronic
1157786178 18:50485038-50485060 GTCTTCTCCAGTAGAGAGGGAGG + Intergenic
1163722171 19:18903484-18903506 GTCCCCCCCGCTAGGGGAGGGGG - Intronic
1165148673 19:33748656-33748678 GTCTCCTGCAATAGAGGACAAGG - Intronic
1165610402 19:37146627-37146649 GGCTGCTCCAGTGGAGGAGGTGG + Intronic
1167550687 19:50158688-50158710 GTATGCACCAGTAGAGGAGGAGG - Intronic
1168427807 19:56252988-56253010 GGCTCTGCCACTAGAGGGGGTGG - Intronic
1168467607 19:56616757-56616779 GTCTCCTCAACTTGGGGAGTTGG + Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
925703996 2:6666791-6666813 GTGTCCTCCCATAGTGGAGGGGG - Intergenic
927336436 2:21930191-21930213 GCCTCTTCCACTAGAAGAGTTGG + Intergenic
927997806 2:27498351-27498373 GTCACCTCCAGAAGTGGAGGGGG - Intronic
928190974 2:29167772-29167794 GACTCCTCCACCTGAGGATGGGG - Intronic
929312908 2:40446137-40446159 GTTTCCTCTACTAGGGTAGGTGG - Intronic
930031561 2:47061116-47061138 GTCTCTTCCAACAGAGCAGGAGG - Intronic
935064852 2:99638596-99638618 GTCTTCTCCACTAGCAGAGAAGG + Intronic
935991336 2:108721290-108721312 GTCTATTCCTCCAGAGGAGGAGG + Intronic
937324659 2:120983295-120983317 GTTTCCTCATCTAGAGGATGGGG - Intronic
938776389 2:134544982-134545004 GTCGCCTCCCCTCCAGGAGGGGG - Intronic
939585392 2:143998084-143998106 GTTTCCTCCAAAAGAGGCGGTGG - Intronic
942479312 2:176366233-176366255 GTCTCATCCTCCAGAGTAGGTGG - Intergenic
945250316 2:207760373-207760395 ATCCCCTCCACTAGATGAGGAGG - Intronic
947623237 2:231604241-231604263 GTCTCCTCCCCCAGGGCAGGTGG + Intergenic
947707772 2:232290485-232290507 GTCACCTTCAGAAGAGGAGGCGG + Intronic
948438605 2:237970636-237970658 GTCTTTTCCACTAGAGGACACGG - Intronic
949046744 2:241875804-241875826 AGGTCCTCCACTAGAGGTGGAGG + Intergenic
1170339481 20:15307299-15307321 GTTTCCTCCACCAGAGGATAAGG + Intronic
1170723481 20:18904387-18904409 GAAACCACCACTAGAGGAGGGGG - Intergenic
1173838000 20:46138362-46138384 GTCCCCTGCACTTGAGGTGGCGG - Intergenic
1174427125 20:50439698-50439720 GCCTCCCCAACCAGAGGAGGTGG + Intergenic
1174506048 20:51018281-51018303 GCCTCCTCCCCTAGAAGATGGGG + Intronic
1175720330 20:61281745-61281767 GTCCCCTCCAGGGGAGGAGGTGG - Intronic
1180911754 22:19455642-19455664 CTCTCCTCCAGGACAGGAGGAGG - Intronic
1182014358 22:27026595-27026617 TTCTCCTCCACTAGCAGAGGAGG + Intergenic
1182962454 22:34488409-34488431 GTCTCCTTCACTAGAAGATAAGG - Intergenic
1183010686 22:34944245-34944267 GGTTCCTCCACTAGAGAAGGAGG + Intergenic
1183284198 22:36952247-36952269 GTCTCCCCACCTAGAGGGGGAGG - Intergenic
1183459326 22:37940518-37940540 GTCTCTTCACCTAGAGGATGGGG - Intronic
1184585697 22:45446617-45446639 GTCTCCTCCACTGGACGACCAGG - Intergenic
951346564 3:21553843-21553865 ATCTCCTCCATGAAAGGAGGAGG + Intronic
952344234 3:32469057-32469079 GTCTGGTCCAGGAGAGGAGGAGG - Intronic
953012461 3:39039990-39040012 GTCTCTACCTCTAGAGGGGGTGG - Intergenic
954636839 3:52075554-52075576 GGCTCCCCCTCTGGAGGAGGTGG - Exonic
954808986 3:53236421-53236443 GTGGCCTCCACCACAGGAGGTGG + Intronic
956108664 3:65848783-65848805 GTCTTCTCCACTTGAAGATGGGG - Intronic
957012609 3:75025639-75025661 GTATCCTCCAGAAGAAGAGGAGG - Intergenic
963866368 3:150366440-150366462 GTCTCAGCTACTGGAGGAGGGGG - Intergenic
963957846 3:151275078-151275100 GTCTCTCCCACTATAGAAGGTGG + Intronic
964903164 3:161685856-161685878 GTGACCTCCACTATTGGAGGTGG + Intergenic
967972513 3:195009915-195009937 GTCTCCTCCCTTAGAGGGAGAGG + Intergenic
969205035 4:5637285-5637307 GTAACCTCCACTGCAGGAGGGGG + Intronic
969531421 4:7733074-7733096 GTGTCCTCCACTAGGGGGGAGGG - Intronic
970276560 4:14407193-14407215 GTCTGCTCCACTATAGAAGCAGG - Intergenic
971014270 4:22471105-22471127 GTCTGCTCCTCCAGAGGAGCAGG + Intronic
972613094 4:40673246-40673268 GTTTCCTCCTCTGCAGGAGGAGG + Intergenic
975907499 4:79231589-79231611 GACTCCTCCACTAGAAAATGTGG - Intronic
979393908 4:120162709-120162731 GTGTCCTCCCATGGAGGAGGAGG - Intergenic
984943672 4:184954902-184954924 CTCTTCTCCAGAAGAGGAGGAGG - Intergenic
985371012 4:189285046-189285068 GGCTGCTCCAGTAGAGGACGGGG - Intergenic
986972182 5:13349775-13349797 GCCTCTTCTACAAGAGGAGGTGG - Intergenic
987014213 5:13800889-13800911 GTCTCCTCCACTAGAAGGTAAGG + Intronic
987480663 5:18453123-18453145 GTCACTTCAACTGGAGGAGGAGG + Intergenic
994087951 5:95780778-95780800 GTCTCTTCCACAAGAAGAGGAGG + Intronic
994497646 5:100534362-100534384 TTCTCCTCCATGACAGGAGGTGG + Intergenic
996152597 5:120058186-120058208 GTCTCCTCCACTGTCAGAGGTGG - Intergenic
997779906 5:136646223-136646245 CTCCCCTCCATTAAAGGAGGTGG + Intergenic
999444976 5:151632106-151632128 GTCTCCTCCACTTGTTGAAGGGG + Intergenic
1000273075 5:159705310-159705332 CTCTCCTCCCCCAGAGGTGGTGG + Intergenic
1003604416 6:7546039-7546061 GTCTCCTCCATTGGAGGAGCAGG + Intronic
1004305926 6:14501998-14502020 GTCTCCTCCTCTTCAGAAGGTGG - Intergenic
1004564436 6:16782109-16782131 GTCTCCTACAAAACAGGAGGAGG + Intergenic
1005661241 6:28001415-28001437 GTGTCCTCCACCACAGTAGGGGG - Intergenic
1006104831 6:31710263-31710285 GCCCCCTCCCCTAGAGGAGGTGG - Intronic
1011099580 6:83707946-83707968 GTTTCCTGCAGAAGAGGAGGCGG - Exonic
1011788403 6:90871223-90871245 GTGTCCATCACTAGAAGAGGAGG + Intergenic
1014035578 6:116764638-116764660 GTCTCCTGCCCCAGAAGAGGAGG + Intronic
1015451720 6:133377079-133377101 GTCTCCTCCACTAGAGGAGGAGG + Intronic
1017161057 6:151366407-151366429 GTCTCCTCCCCGGGAGGAGGGGG + Exonic
1018981824 6:168607241-168607263 GCCTCATCCAGTAGAGGAGGTGG - Intronic
1019425457 7:974305-974327 GTCTCATCCTCTAGAGTAGCTGG - Intronic
1019778647 7:2927007-2927029 GCCTCCTCCAGCAGGGGAGGAGG + Intronic
1020152282 7:5691946-5691968 ATCTCTTCCACTAGAGTAGGAGG - Intronic
1025118665 7:56280397-56280419 GTCTCATCTACTACAGGAGAGGG - Intergenic
1025254223 7:57372675-57372697 GTCTCCCCCAGTAGAGGACATGG - Intergenic
1026973211 7:74480402-74480424 CTCTCTTCCAGTGGAGGAGGGGG - Intronic
1029403524 7:100359509-100359531 TTCTCCTCCACCACAGGAGGAGG - Exonic
1039483584 8:37894050-37894072 GTTTCCTACACTAGAGTGGGAGG + Intronic
1043948992 8:86286800-86286822 GTGTCCTCCACTGTTGGAGGTGG - Intronic
1048223758 8:132566016-132566038 CTCTCCCACACTGGAGGAGGCGG - Intergenic
1048270408 8:133023646-133023668 GTCACCACCTCTAGAGGAAGGGG - Intronic
1051376161 9:16404922-16404944 GGCTCCTCCACTAAGGCAGGAGG + Intergenic
1056740940 9:89255060-89255082 GCCTCCTCCACTAGGGTAAGTGG + Intergenic
1056855820 9:90128729-90128751 GCCTCCTCCAGGAGAGGAGAAGG - Intergenic
1060494917 9:124111542-124111564 GGCTGCTCCCCTGGAGGAGGGGG - Intergenic
1060980106 9:127786623-127786645 CCCTCCCCCACTACAGGAGGAGG - Intronic
1189601934 X:42636101-42636123 ATCTGCTTCACTGGAGGAGGTGG + Intergenic
1189727079 X:43977994-43978016 GTCTCCTAGACAAGAGAAGGTGG + Intergenic
1189915905 X:45855781-45855803 GTGTCCTCCCCTAGAGGAACTGG + Intergenic
1191873851 X:65773775-65773797 GTCACCTCCACAATAGCAGGAGG + Intergenic
1191907626 X:66110416-66110438 ATCTCCTCTAATAGAGGATGCGG - Intergenic
1192080198 X:68040426-68040448 ATCTCCTCCCCTAGAGAAGCAGG + Intergenic
1193192191 X:78583860-78583882 GTTATCTCCACTAGTGGAGGTGG + Intergenic
1194414400 X:93592602-93592624 GTCACCTCCACTAGACTAGAAGG + Intergenic
1197057165 X:122135173-122135195 CTCTCCACCATTAGAGGGGGGGG + Intergenic
1200963217 Y:9013759-9013781 GTCTGGTCCCCTGGAGGAGGAGG + Intergenic