ID: 1015453228

View in Genome Browser
Species Human (GRCh38)
Location 6:133395136-133395158
Sequence TCCAGAACCTTCAAGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015453228 Original CRISPR TCCAGAACCTTCAAGGAATT TGG (reversed) Intronic
901328167 1:8382108-8382130 TCCAGCACACTGAAGGAATTTGG - Intronic
903191088 1:21656559-21656581 TCCAGAAGCTTCCTGGGATTGGG - Intronic
903937925 1:26909645-26909667 TCCAGAAGATTCAGGGATTTAGG - Intronic
905313194 1:37064897-37064919 TCCAGAGCCTCCAAGGCAGTGGG - Intergenic
905716471 1:40155485-40155507 CCCAAAACCTTCAAGACATTAGG + Intergenic
906446351 1:45902163-45902185 TTAAAAACCTTCAACGAATTAGG - Intronic
907017380 1:51030234-51030256 TCCATAATCTATAAGGAATTTGG - Intergenic
907147969 1:52253925-52253947 TTCACAACCTTCAAGAAATTCGG + Intronic
907967213 1:59343986-59344008 TCCACAACCATCAATGAATCAGG - Intronic
910021772 1:82599425-82599447 CCCAGAACCTTCAAGTCATAAGG - Intergenic
918778527 1:188667903-188667925 TACAGAACCTTGAAGAAATCTGG + Intergenic
920580005 1:207097471-207097493 TCCAGCACTTTCCAGGACTTTGG - Intronic
920833226 1:209484001-209484023 TCCACAGCCTTCAAGAAAATAGG - Intergenic
921017732 1:211207656-211207678 TCCAGAGCTGTCCAGGAATTTGG + Intergenic
921223415 1:212992249-212992271 TCCAGAGAGTTCAAGGGATTGGG - Exonic
921407466 1:214796809-214796831 AACAGAGCCTTCAAGGAATATGG + Intergenic
922636174 1:227173963-227173985 TTCAGTAACTACAAGGAATTTGG - Intronic
1063045680 10:2390116-2390138 ACCACAACCTCCAAGGATTTGGG - Intergenic
1063966831 10:11352545-11352567 TTCAGAACTTTCTAGGAAATGGG + Intergenic
1066028146 10:31386246-31386268 TCCATTCCTTTCAAGGAATTTGG + Intronic
1066253824 10:33659670-33659692 TCGAAAACCTTCAAAGAAATTGG - Intergenic
1068735291 10:60407311-60407333 TCCATTTCCTTCAAGGTATTTGG - Intronic
1069003248 10:63289696-63289718 TCCAGAAACTTTAAGTAATATGG - Intronic
1069015818 10:63427714-63427736 TCCAGAAGTGTCCAGGAATTTGG + Intronic
1069502339 10:68965090-68965112 AGCAGAGCCTTCAAGCAATTGGG - Intronic
1071165658 10:82803205-82803227 TGCAGACCATTCAAGGGATTCGG + Intronic
1071751928 10:88489063-88489085 TTCAGAACCATAATGGAATTGGG - Intronic
1072165276 10:92807113-92807135 TCCCCACCTTTCAAGGAATTTGG - Intergenic
1072459325 10:95604979-95605001 CACAGAAACTTCAAAGAATTGGG - Intergenic
1073198381 10:101714256-101714278 TCCAAAACATATAAGGAATTTGG - Intergenic
1073715659 10:106103689-106103711 TACAGAATCTACAAGGAACTTGG - Intergenic
1074351906 10:112746117-112746139 TCCAGAGTCTTCAAGGAAGTTGG - Intronic
1077482612 11:2823427-2823449 TCCAGAACCTTCTAAGAAAAGGG - Intronic
1078517587 11:12036992-12037014 TTAAAAACCTTCAAGAAATTAGG + Intergenic
1084080719 11:66822661-66822683 TCCAGACCCTTCAAGTTAGTAGG + Exonic
1085902907 11:80723247-80723269 TCCAGATACTTCTAGGATTTAGG + Intergenic
1091073669 11:132593244-132593266 TCCAGAACCAGCAAGGATGTCGG + Intronic
1093510698 12:19923906-19923928 TCCAGAAAATTCAACAAATTTGG + Intergenic
1095972502 12:47912277-47912299 TCAAGGACCTCCAAGAAATTAGG - Intronic
1097140403 12:56897977-56897999 CTCAGAAGCTTCCAGGAATTTGG + Intergenic
1098106285 12:67070844-67070866 TCCAGAAGCTTCAAGGATAGAGG + Intergenic
1098549595 12:71748466-71748488 ACAAGAAATTTCAAGGAATTTGG - Intergenic
1100576754 12:95899038-95899060 TCCAGTACTTTCTGGGAATTGGG + Intronic
1101250482 12:102929415-102929437 TCCAGAACCTTCCAGGCAGAAGG + Intronic
1103277710 12:119726963-119726985 TCAAAAACCTTCATGAAATTTGG + Intronic
1104301034 12:127565217-127565239 TGCAGAACCTTCAGGGAAAGTGG + Intergenic
1109236896 13:59832731-59832753 TACAAAAGCTGCAAGGAATTTGG + Intronic
1110851708 13:80253443-80253465 TCCACAATCATCAAGGCATTGGG - Intergenic
1112239587 13:97668282-97668304 TCCAGAATCTACAATGAACTCGG - Intergenic
1112589237 13:100748615-100748637 TCCAGAACCTGCAAGGAGCCTGG - Intergenic
1113729987 13:112634442-112634464 CCCAGAAATTCCAAGGAATTAGG + Intergenic
1115248825 14:31324923-31324945 TACAAAACATTCCAGGAATTTGG + Intronic
1117917303 14:60691432-60691454 TCCATAAGCTTCAAGGAAGTAGG + Intergenic
1118569826 14:67183273-67183295 GCCAGACTCTTCTAGGAATTTGG - Intergenic
1119282791 14:73424279-73424301 CCCAGAACCTTTCAGGTATTAGG - Intronic
1120400181 14:84021595-84021617 TCCACAAGCTAGAAGGAATTGGG - Intergenic
1122695640 14:103550869-103550891 CCCAGAACCTTCCCGGAATGGGG - Intergenic
1123965418 15:25451056-25451078 TCCAGATCTTTCAGGGATTTGGG + Intergenic
1125089064 15:35769710-35769732 ACCAGAGCCATCAATGAATTTGG - Intergenic
1125759361 15:42086334-42086356 TCCAGAACATTCTAGGAACCAGG + Exonic
1131056171 15:89376679-89376701 TCCAGAACCTTGAGGGAAGCTGG - Intergenic
1137303504 16:47177672-47177694 TCCAGAATATTCAGGGCATTGGG - Intronic
1137846414 16:51693529-51693551 TCCACAACCTTCCCAGAATTTGG - Intergenic
1137861015 16:51847018-51847040 TCCAGAACCTTTAAGCTATTAGG - Intergenic
1138782381 16:59804742-59804764 TACAGAACATTGAAGTAATTAGG - Intergenic
1142907690 17:3056362-3056384 TCTTGAACATTCCAGGAATTGGG - Intergenic
1142926875 17:3247897-3247919 TCTTGAACATTCCAGGAATTGGG + Intergenic
1143963746 17:10741347-10741369 TCCAGATCCTGCCAAGAATTAGG - Intergenic
1147333882 17:39715497-39715519 TCCAGAACCTGCAAGTAATCCGG + Exonic
1148454581 17:47804225-47804247 TTCAGAAGATGCAAGGAATTGGG + Intergenic
1148498420 17:48069661-48069683 TCCAAAATTTTCCAGGAATTTGG - Intergenic
1151314975 17:73316284-73316306 TCCAGCCCCTCCAAGGAAATAGG - Intergenic
1151457457 17:74234417-74234439 TCCTGAAACTTTAAGGAATTGGG + Intronic
1152865298 17:82718975-82718997 TCCAGAACCTTGATGGGCTTGGG - Exonic
925867482 2:8241501-8241523 TCCAGAACGTTCAGGGAAGCAGG + Intergenic
926043457 2:9692771-9692793 TCCACCAACTTCAGGGAATTGGG - Intergenic
926985024 2:18613155-18613177 ACCAGCACCTTCTAGGAATGTGG - Intergenic
927149046 2:20185376-20185398 TCCAGAAACTTCCAGGAGTCAGG - Intergenic
928748043 2:34438172-34438194 TCAAGAATTTTCAAAGAATTGGG + Intergenic
929175706 2:38973303-38973325 TCAAGGACCTTCACTGAATTTGG - Intronic
930288683 2:49466814-49466836 TCCAGATATTTCAAGGGATTTGG + Intergenic
930350805 2:50251905-50251927 TCCAGAATCTACAAGGAACCTGG - Intronic
931566714 2:63622392-63622414 TCCAGAGCTGTCCAGGAATTTGG - Intronic
932047932 2:68368775-68368797 TCCATAAACCTCTAGGAATTAGG - Intronic
932821101 2:74901483-74901505 TCCTAAACCTTCAAAGAAATGGG + Intergenic
934979602 2:98829157-98829179 TTCAGAGCCTTCAGGGTATTGGG - Intronic
937477648 2:122229473-122229495 TCCTCAGCCTTCAAGGAATCTGG + Intergenic
938465436 2:131521966-131521988 TCCAGAAGCTCCAAGGATTGCGG + Intergenic
940042227 2:149372614-149372636 TGCAGAGCATTCAAAGAATTTGG + Intronic
941437745 2:165492352-165492374 TGTAGAGCCTTCAAGGACTTTGG - Intronic
941686648 2:168455347-168455369 TCTAAAACCTTTAAGGCATTAGG - Intergenic
942458290 2:176152332-176152354 TCCGGAACCCTCAAGCATTTTGG - Intronic
945834561 2:214823179-214823201 TCCAGAACCTGGAAATAATTGGG + Intergenic
946498070 2:220216146-220216168 CCCAGAACCTTCAGGCATTTGGG - Intergenic
946815141 2:223569455-223569477 TCCAGAAGCTTAAAGGGCTTAGG - Intergenic
1170436771 20:16338406-16338428 CTCTAAACCTTCAAGGAATTGGG - Intronic
1170972439 20:21128437-21128459 TCCAGAAACTTCTGGGAAGTGGG + Intronic
1171484545 20:25477514-25477536 CCCAGCAGCTTCAGGGAATTAGG - Intronic
1171774894 20:29356138-29356160 TACAAAACCTTCAAGAAATATGG + Intergenic
1174490429 20:50889475-50889497 ACTAGAACCTTTAAGGAATTTGG - Exonic
1175011988 20:55747180-55747202 TTCAGAACCTTGCAGGATTTTGG - Intergenic
1183756361 22:39769933-39769955 TCCAGAAAGTTTTAGGAATTGGG + Intronic
1183792828 22:40087682-40087704 TCCAGAGCCTTCAAGCAAAGGGG + Intronic
1185093973 22:48795774-48795796 TCCAGAACCTTCCCAGAAATGGG - Intronic
949771481 3:7583643-7583665 TAAAGAACAGTCAAGGAATTGGG + Intronic
950961160 3:17109353-17109375 TGCAGAACCTGCAAGGAACTCGG + Intergenic
955171805 3:56573404-56573426 GCCAGAAACTTCAAGGTGTTGGG + Intronic
955234261 3:57125658-57125680 TCCAGAACCTTGGAGGATTGTGG + Intronic
956886579 3:73566036-73566058 TCCAGAGCATTCAGGTAATTAGG + Intronic
958484425 3:94685611-94685633 TCCAGACTCTACAAGGAACTCGG + Intergenic
958782002 3:98553837-98553859 TCCTAAACCTTGCAGGAATTTGG - Intronic
960082128 3:113552893-113552915 TCCAGAACATGCAAGGGTTTTGG + Intronic
960746358 3:120894161-120894183 TCCAGAAAATTCAAGATATTTGG + Intergenic
963896278 3:150688411-150688433 TGCAGTAACTTCAAAGAATTAGG + Intronic
966226725 3:177605714-177605736 TCCATTTCCTTTAAGGAATTGGG - Intergenic
966851850 3:184169744-184169766 GCCAGGGCCTTCAAGGGATTGGG + Intronic
969993652 4:11290083-11290105 TCCAGAACTTTAATGGAAATAGG + Intergenic
972246585 4:37251406-37251428 CCCAGATCTTTCATGGAATTAGG + Intronic
972476740 4:39457748-39457770 TCTAGAATCTTAAAGTAATTCGG - Intronic
973819127 4:54647176-54647198 TCCAGAGCATTGAAGGGATTTGG + Intergenic
974156446 4:58079436-58079458 TCCAGAAGCTTAAAGGATATTGG - Intergenic
974476201 4:62384647-62384669 TCCATAATCTTCAAGCATTTAGG + Intergenic
974821798 4:67076055-67076077 TCCTGATCCTTCAAGTACTTGGG + Intergenic
974896684 4:67948560-67948582 TCAAGAATCCTCATGGAATTTGG + Intronic
978756117 4:112304622-112304644 TCCAGAATCTACAAAGAACTTGG - Intronic
978860885 4:113447579-113447601 TCCAGATACTTCTAGGAGTTGGG + Intergenic
979723639 4:123933720-123933742 TCCAGCATCTTCAAAGAATAAGG - Intergenic
980212443 4:129807247-129807269 TACAGAACCTTGAAGAAACTTGG + Intergenic
980615878 4:135225005-135225027 TCAAGAATCTTCCAGAAATTTGG - Intergenic
981166276 4:141561788-141561810 TCCAGAATATTATAGGAATTCGG - Intergenic
981465392 4:145064572-145064594 TTCACAACCTTCAAGAAATTCGG - Exonic
985509478 5:304735-304757 TACAGAAGCATCAAGGAAGTTGG - Intronic
985738796 5:1602155-1602177 TACAGAAGCATCAAGGAAGTTGG + Intergenic
987490756 5:18577956-18577978 TGCAGAACCATCCATGAATTGGG + Intergenic
988078285 5:26381997-26382019 ACCACAACCTTGCAGGAATTTGG + Intergenic
988499101 5:31769157-31769179 TCCAGACCCTTCAAGCCATGTGG + Intronic
990536233 5:56725461-56725483 TCCAGAACCTTGTAGGATTGTGG - Intergenic
991998327 5:72410611-72410633 TCCAAAACCTTCAATAAAATGGG - Intergenic
998054339 5:139061539-139061561 TTCAGAAACATAAAGGAATTTGG - Intronic
998543212 5:143002918-143002940 TCTAGAAGCTTGAAGAAATTTGG + Intronic
999194194 5:149771059-149771081 TCTAGAACCTTGAAGGAATTGGG + Intronic
1000111522 5:158112552-158112574 TCCGGAAGCTGAAAGGAATTAGG + Intergenic
1000392917 5:160744219-160744241 TCCAGCACCTTCTGAGAATTTGG - Intronic
1000908457 5:166992684-166992706 TCCTGATTCTTCAAAGAATTTGG - Intergenic
1002088815 5:176792713-176792735 TCCAGAACCCTCAGGGACCTCGG - Intergenic
1003575405 6:7289256-7289278 CCCAGTGGCTTCAAGGAATTTGG - Exonic
1004451919 6:15755271-15755293 TCCAGAATATTCAAGGAAGATGG + Intergenic
1005144935 6:22678772-22678794 TACAGAACCTGTAAGGAATAGGG - Intergenic
1005423684 6:25678987-25679009 TCCAGAACTGTCCAGGAACTTGG - Intronic
1005754001 6:28909429-28909451 TCCATGACCTTCCAGGAACTAGG + Intronic
1006132575 6:31878154-31878176 TCCAGAATCTGCAAGGAAAAGGG - Intronic
1008159720 6:48062356-48062378 TTCAGAACCACCAAGGACTTGGG - Intronic
1009660408 6:66604345-66604367 TCCAGAAAATTCAAAGAATTTGG - Intergenic
1011005379 6:82638585-82638607 AACAAAACCTTCAAGGATTTGGG + Intergenic
1013906000 6:115220736-115220758 GCCAGAAACTTTGAGGAATTTGG + Intergenic
1014094378 6:117444425-117444447 TCCAGAACATCCAAGGTGTTAGG - Intronic
1014660344 6:124162575-124162597 TCCAGAATGTTTATGGAATTTGG + Intronic
1015453228 6:133395136-133395158 TCCAGAACCTTCAAGGAATTTGG - Intronic
1016285186 6:142464387-142464409 TTGAGGACCTTCAATGAATTTGG + Intergenic
1016430884 6:143984011-143984033 TCCTGAATCTTCAAGGAATAAGG + Intronic
1017034048 6:150251179-150251201 GCCAGAAACTCCAAGGAATTTGG - Intergenic
1019018537 6:168898803-168898825 TCCAGAACATTCCAGGTATAAGG + Intergenic
1019062578 6:169266682-169266704 TCAAGAACCTTCTAGAAATGGGG - Intergenic
1024747665 7:52427128-52427150 TTCAGAACTTTCTAGGAAATGGG - Intergenic
1029047038 7:97640594-97640616 TCCAGAAACTTCAGGGTAATAGG - Intergenic
1032647027 7:133836042-133836064 TCCAGAACCTGAAAGAAATAAGG - Intronic
1033704801 7:143876282-143876304 TCCAGAGCCCTCGAGGATTTTGG + Exonic
1034289575 7:149918866-149918888 TCCAGAGCCTTTAAGGATCTAGG - Intergenic
1034319722 7:150168984-150169006 TCCCTAACCTTCAATGCATTGGG + Intergenic
1034631153 7:152531469-152531491 GCCAGAACCTTCAATAAATATGG - Intergenic
1034661487 7:152773957-152773979 TCCAGAGCCTTTAAGGATCTAGG + Intronic
1034696547 7:153059123-153059145 TCCTGGACCTTCAAGGAGATTGG + Intergenic
1034773031 7:153798235-153798257 TCCCTAACCTTCAATGCATTGGG - Intergenic
1035919399 8:3660908-3660930 TCAAGAAACTTCTATGAATTGGG - Intronic
1036788618 8:11703705-11703727 TCCTGAACCTCCAAGGAATCCGG + Intronic
1037878918 8:22563420-22563442 TCCAGCACCCTCATGGAACTAGG + Intronic
1039883133 8:41639259-41639281 TCCAGCACCTTCTAAGAAATGGG - Intergenic
1042472020 8:69201242-69201264 GCCAGAACCCTCAAGGTATAAGG - Intergenic
1044543901 8:93437655-93437677 TGCAGAACCTTCAGGGAATGTGG + Intergenic
1044875415 8:96660579-96660601 TTCAGAACCTACAAGAAGTTGGG - Intronic
1050783023 9:9363037-9363059 TCCAGAACTCTCAAGGAAAAGGG - Intronic
1051145363 9:14021645-14021667 TAAAGAAACTTCCAGGAATTAGG - Intergenic
1055257298 9:74386516-74386538 TCCAAAACCTAAAAGTAATTTGG + Intergenic
1055781298 9:79824251-79824273 GCTAAAATCTTCAAGGAATTAGG + Intergenic
1056055848 9:82823207-82823229 TTCAGGACCTTCAAGGGTTTGGG - Intergenic
1057754700 9:97822894-97822916 TCCAAAACCTACCTGGAATTTGG + Intergenic
1058396545 9:104560138-104560160 TACAGAATCTACAAGGAATTCGG + Intergenic
1058447667 9:105068077-105068099 TCCAGTGCCTCCAAGGAAATGGG + Intergenic
1062352416 9:136145629-136145651 TCCGGAACCTTCCAGGGATTGGG - Intergenic
1186626002 X:11294772-11294794 TTCAGAACCATCAAGAAATGGGG + Exonic
1186868331 X:13743942-13743964 TACAGAACCTGGAAGGAATAAGG - Intronic
1186891712 X:13965553-13965575 TCCAGAACTTGCAAGGAGATTGG - Intergenic
1187459448 X:19473207-19473229 TCCAGAAAGTTTAAGAAATTTGG + Intronic
1187471877 X:19576991-19577013 TCCAAAACTTTCCACGAATTTGG + Intronic
1188348413 X:29097144-29097166 TCCAGTACCTTCTAAGATTTAGG - Intronic
1188856490 X:35202385-35202407 TCCAGAACATTCCTGGAATTTGG - Intergenic
1190774847 X:53544488-53544510 TCCTGCACCTCCAAGGAATCTGG + Intronic
1193084022 X:77432380-77432402 CCCAGAACCTTTTAGGGATTGGG - Intergenic
1194538209 X:95134366-95134388 TCCAGACCTTTCAAAGTATTCGG - Intergenic
1196069339 X:111502639-111502661 CCCAGATGCTTCAAGGATTTGGG + Intergenic
1196783421 X:119402203-119402225 TCCAGAATGTTCAGGGAATGGGG + Intronic
1197348509 X:125353600-125353622 TCCCCAATCTTCAAAGAATTTGG - Intergenic
1197493845 X:127153324-127153346 TCCAGAACCATCCAAGAATCTGG - Intergenic
1199361517 X:146925139-146925161 TCCAGAATCTGTAAGAAATTTGG - Intergenic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200742847 Y:6872603-6872625 TTCAGAACCATCAAGAAATGGGG - Exonic
1200747014 Y:6911531-6911553 CGCAAAACCGTCAAGGAATTCGG + Intronic
1200830798 Y:7687524-7687546 TCCAGAACATTCAGGCCATTGGG - Intergenic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic
1201798635 Y:17928458-17928480 TCCAGAACCTTCAGGAATTAAGG + Intergenic
1201802918 Y:17977499-17977521 TCCAGAACCTTCAGGAATTAAGG - Intergenic