ID: 1015460595

View in Genome Browser
Species Human (GRCh38)
Location 6:133487086-133487108
Sequence AGGGAGAGCTCAGTGAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 740
Summary {0: 1, 1: 3, 2: 41, 3: 155, 4: 540}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015460588_1015460595 24 Left 1015460588 6:133487039-133487061 CCAGCAGCAGCTGAATGGCACAG 0: 2
1: 1
2: 8
3: 53
4: 290
Right 1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG 0: 1
1: 3
2: 41
3: 155
4: 540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015460595 Original CRISPR AGGGAGAGCTCAGTGAGTGT AGG Intronic
900537929 1:3187953-3187975 AGGCAGAGGACAGTGTGTGTGGG + Intronic
901007086 1:6177276-6177298 AGGAAGAGCTCAGGGTGAGTGGG + Intronic
901312791 1:8282416-8282438 AGGGAGATCTCAGAGAAGGTGGG + Intergenic
901681041 1:10913007-10913029 AATGAGAGCTCAGGGAATGTGGG + Intergenic
901751447 1:11412460-11412482 GGGGAGGGGGCAGTGAGTGTGGG + Intergenic
902600490 1:17537559-17537581 AGGGAGAGGTCAGGGAATGGAGG + Intergenic
902824606 1:18964463-18964485 AGGGAGGGCTCATTGAGGGAGGG + Intergenic
902932983 1:19744490-19744512 AGTGAGAGATCAGTATGTGTTGG - Intronic
903575549 1:24337602-24337624 AGGGAGAGGACAGTGAGGCTGGG - Intronic
904116969 1:28170038-28170060 AGTGAGAGCTCATTGAATGTTGG + Intronic
904339489 1:29824884-29824906 AGTGAGTGCTCAGTCAGGGTTGG + Intergenic
904456854 1:30653023-30653045 AGCGAGTGCTCAATCAGTGTGGG - Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906678120 1:47708071-47708093 AGGGGGAGCTCAGTGACTCGCGG - Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907759860 1:57347094-57347116 AGGGAGAGCCCATTCAGTGCAGG + Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
908478865 1:64517418-64517440 AAGGAGAATTAAGTGAGTGTGGG + Intronic
908599053 1:65719310-65719332 AGGGGCAGCTAAGGGAGTGTGGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
909866610 1:80681214-80681236 AGAGAGAGCTCAGGGAGAGCAGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911977805 1:104523804-104523826 AGTGAGAGCTCATTAAATGTTGG - Intergenic
912229611 1:107776852-107776874 AGGGAGAGATAAGTGTGGGTTGG - Intronic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
913182614 1:116336814-116336836 AGGTAATGCTGAGTGAGTGTGGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
916744401 1:167673484-167673506 AGGAAGCTCACAGTGAGTGTTGG + Intronic
916809052 1:168289707-168289729 AGTGAGTGCTCTGTAAGTGTTGG + Intronic
917083362 1:171279975-171279997 AGGGAGAGATCACTTCGTGTTGG - Intronic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918494576 1:185119763-185119785 AGGGTGATCTCAGTGAGACTTGG + Exonic
918892707 1:190295753-190295775 AGGGAAAGGGAAGTGAGTGTGGG - Intronic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
920034676 1:203058276-203058298 AGGGAGAGGTCTGTGTGTGAAGG + Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920852886 1:209640600-209640622 AGGGAATGCACAGTGAGTGGTGG - Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
921797312 1:219361497-219361519 GTGGAGAGCTCAGAGAATGTAGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
923526538 1:234777116-234777138 AGGGAGAGGCCAGTGAAGGTCGG + Intergenic
923918051 1:238530566-238530588 AGGGAGAGGCCAGGGAGTGAGGG + Intergenic
924450187 1:244171558-244171580 AGGCAGAGGTCAGTGTGTTTGGG - Intergenic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
924855128 1:247868321-247868343 AGGTAGAGCTCTGTCAGTATGGG - Intronic
1064127683 10:12677753-12677775 AAGGAGAGCTCAGTCTGTGAGGG + Intronic
1064615031 10:17144512-17144534 AGGGAGACTTCAGTAAGTGCTGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065083582 10:22151587-22151609 AGTGAGAGCGTAGTGAGTGCCGG - Intergenic
1065916573 10:30358445-30358467 TGGGAGAGGCCAGTGTGTGTAGG + Intronic
1066228368 10:33407190-33407212 AAGGAGAACTGAGTGAGTGTGGG + Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1067291490 10:44946655-44946677 AGGCAGAGCTGAGAGAGGGTAGG + Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069062616 10:63910026-63910048 ACAGAGAGGTCAGTGAGTGCAGG - Intergenic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069244481 10:66186315-66186337 AGAGAGAGATGAGTGTGTGTTGG + Intronic
1070460974 10:76669782-76669804 AGGAAGAGCTCTGTGTGGGTGGG + Intergenic
1070803058 10:79254783-79254805 AGGGAGAGCCGACTGAGTGAGGG + Intronic
1071103074 10:82061645-82061667 AGAGTGAGCTCAGTGAATGCTGG + Intronic
1071757148 10:88555814-88555836 AGGGAGATGCCAGTGAGTGAGGG - Intronic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1073143162 10:101262191-101262213 AGGGAGAGCTCAGTCTAGGTAGG - Intergenic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1073870918 10:107863245-107863267 ACAGAGACCACAGTGAGTGTGGG + Intergenic
1074225435 10:111479858-111479880 AGGGTGAGGTGAGTTAGTGTGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1074829540 10:117239413-117239435 AGTGAGAGCTCCGTAAGTGCCGG - Intergenic
1075141335 10:119839306-119839328 AGGCAGAGCACAGAGGGTGTTGG - Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075609015 10:123836560-123836582 AGAGAGGGCTCTGTGGGTGTTGG - Intronic
1075955386 10:126518948-126518970 AGGCAGTGCTCAGGGTGTGTGGG + Intronic
1077577476 11:3395562-3395584 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1077603975 11:3594680-3594702 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1078846475 11:15123314-15123336 ATGATGAGCTCTGTGAGTGTTGG + Intronic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080396810 11:31897809-31897831 GAGGAGAGCTCAGTTAGTGTGGG - Intronic
1080728523 11:34921864-34921886 AGTGAGAGCTCAGTATGTGATGG - Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081490054 11:43560587-43560609 AGTGGGAGCTCAGTGAGACTCGG - Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1083628666 11:64084871-64084893 AGGGAGAGCTGCGTGTGTGGGGG + Intronic
1083713000 11:64560166-64560188 AGGAAGAGCCAGGTGAGTGTGGG - Intronic
1084045785 11:66567109-66567131 AGGGAGAGCTCAGGAATTATGGG + Intronic
1084167090 11:67380079-67380101 AGGGACAACTGAGTGAGTATAGG + Intronic
1084226427 11:67717497-67717519 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1084229427 11:67740344-67740366 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1084259872 11:67969272-67969294 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1084845871 11:71899352-71899374 AAGGGCAGTTCAGTGAGTGTAGG + Intronic
1085052108 11:73385176-73385198 TGGGAGAGCTTAGGGACTGTAGG + Intronic
1085259186 11:75194521-75194543 GGGGAGAGATCAGCGAGGGTGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085643563 11:78208484-78208506 AGGGAAAGGTCAGTGAGGGAGGG + Intronic
1086439232 11:86811912-86811934 AGGAAGCCCTCAGTGAGTGTTGG - Intronic
1086444290 11:86857920-86857942 AGGGAGAGCCCAGTGAGGACGGG + Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089139440 11:116274321-116274343 AGGGGGTGCTGAGTGCGTGTGGG - Intergenic
1090130917 11:124141418-124141440 AAGGAGAGCTCAGAGGGTGAGGG + Intronic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090403710 11:126465061-126465083 AGGGTGTGCTGAGTGTGTGTGGG + Intronic
1090493185 11:127184085-127184107 AGTGAGAGCTGAGTGAGCCTGGG + Intergenic
1090842327 11:130501999-130502021 ACTGAGTGCTCAGTGAGAGTAGG + Intergenic
1091647584 12:2285436-2285458 AGGGAGAGCCCAGGTAGTGGAGG + Intronic
1092434077 12:8432434-8432456 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093696001 12:22161143-22161165 AGGGAGATAACAGGGAGTGTTGG + Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096112004 12:49034399-49034421 AGGGAGTGATCAGTGAGTATGGG - Exonic
1096237936 12:49942517-49942539 AGGAGGAGCTCTATGAGTGTGGG - Intergenic
1096548948 12:52359732-52359754 AGGGTGAGAGCAGTGAGTTTGGG + Intergenic
1097991745 12:65842329-65842351 AGGTAGTGCTCAGTAAATGTTGG + Intronic
1098847425 12:75554870-75554892 AAGGAAAGGTCAGTAAGTGTAGG - Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1101552027 12:105772193-105772215 GGGAAGAGCTCAGCGATTGTTGG - Intergenic
1101584032 12:106068546-106068568 AAGGCAAGCTCACTGAGTGTTGG - Intronic
1101631842 12:106502538-106502560 AGGCAGTGCTCAGTGAAAGTGGG - Intronic
1101696530 12:107132491-107132513 AGGCAGAGCTCACTGACTGTGGG + Intergenic
1102053060 12:109877301-109877323 AGTAAGGGCTCAGTGAGTGACGG + Intronic
1102464267 12:113119351-113119373 TTGGAGACCTCAGTGAGTGGTGG - Exonic
1103588869 12:121976373-121976395 AGGAAGAGCTCAGTGAATGGAGG + Intronic
1104897003 12:132169339-132169361 GGGGAGACCTCAGGGAGGGTGGG + Intergenic
1104997657 12:132668624-132668646 GGGGCGAGTTCAGTGAGTGTCGG - Exonic
1105533337 13:21240758-21240780 AGGAAGTGCTCAGTAAGTGGTGG + Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1107932894 13:45320993-45321015 AGAGAGAGCACACTAAGTGTTGG + Intergenic
1108181735 13:47846728-47846750 AGTAAGAGCTCAGTAAATGTTGG - Intergenic
1109117045 13:58401602-58401624 AGGTAGAGCTCTGTGATTGGTGG + Intergenic
1109554629 13:63955819-63955841 AGGGAGAGCAAAGGGAGTATGGG - Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110538601 13:76681888-76681910 AGGGAGTGGGCAGTGGGTGTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111359384 13:87154908-87154930 AGGCAGAGCTCAGGCAGTATTGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1111800077 13:92970341-92970363 AGGAAGAATTAAGTGAGTGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113755583 13:112808649-112808671 AGGGAGGCCTCTGTGAGTGCAGG - Intronic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1113870198 13:113554481-113554503 AGGGGAAGCTCAGTGAGTAGCGG - Intronic
1114298690 14:21354396-21354418 AGGGTGAGGTGCGTGAGTGTGGG - Exonic
1114417208 14:22552836-22552858 AGGGAGAGCGCAGTGAGCTGTGG - Intergenic
1114624164 14:24117721-24117743 AGTGATATCTCAGTGAGTATGGG + Exonic
1114740059 14:25087578-25087600 AGGGACAGCTGAGTCTGTGTGGG + Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116019217 14:39441120-39441142 AGGGAGAGGCCAGGGAGAGTGGG - Intergenic
1116220950 14:42086126-42086148 TGGGAAAGCTAAGAGAGTGTCGG - Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118806308 14:69240155-69240177 AGGGAGAGGAGAGTGTGTGTGGG + Intronic
1119860368 14:77931700-77931722 AGCGCTAGCTGAGTGAGTGTGGG + Exonic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1120439763 14:84521189-84521211 AGGGGCAGCTCAGGGACTGTGGG - Intergenic
1121046919 14:90794918-90794940 AGGCAGTGCTCATGGAGTGTTGG - Intronic
1121636211 14:95455470-95455492 AGGCTGAGCTCAGTGAGTTCAGG - Exonic
1122191603 14:100048957-100048979 AGGGAGAGCTGAGGGAGCTTGGG + Intronic
1122202844 14:100132966-100132988 AGGGGGTGCTCAGTGAGGGCAGG - Intronic
1122268625 14:100558364-100558386 CCGGAGAGCGCAGTGAGGGTGGG - Intronic
1122543839 14:102511540-102511562 GGGGAGAGCAAAGTGAGTGAAGG + Intergenic
1122594359 14:102879004-102879026 AGGGGGTGCCCAGTGAGTGGAGG + Intronic
1124820015 15:33035560-33035582 AGGGAGAGGTAAGGGAATGTAGG - Intronic
1125489636 15:40136936-40136958 AGGGACAGATCTGGGAGTGTGGG + Intergenic
1125971095 15:43912495-43912517 AGGGAGTGATCAGTGAGTAAGGG - Intronic
1126489145 15:49216808-49216830 AGGGAGGGTGAAGTGAGTGTGGG - Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1126858189 15:52859161-52859183 AGGGAGAGCTCAGTGAGGTGAGG + Intergenic
1127132527 15:55882364-55882386 TGGGAGAGCTCAGTGACAGTGGG + Intronic
1127545669 15:59992951-59992973 AAGGAGGGCTGAGTGAGTGGGGG + Intergenic
1128068889 15:64781397-64781419 AGGGAGAGCTCAGGGATTTGGGG - Intergenic
1128248898 15:66151401-66151423 AGGGAGAGAACCCTGAGTGTGGG + Intronic
1129210417 15:74064904-74064926 TGGGAGAGGCCAGTGTGTGTGGG + Intergenic
1129403597 15:75300469-75300491 TGGGAGAGGCCAGTGTGTGTGGG - Intergenic
1130139238 15:81209703-81209725 AGGGAGAAGTGAGTGGGTGTGGG - Intronic
1130141461 15:81229707-81229729 AGGGAGAAGTGAGTGGGTGTGGG - Intronic
1130485467 15:84396031-84396053 TGGGAGAGGCCAGTGTGTGTGGG - Intergenic
1131894829 15:97015604-97015626 AGGGAGATCTCTTGGAGTGTAGG + Intergenic
1132135509 15:99334075-99334097 ATGGAGAGCTCATTGAGGCTGGG - Exonic
1132311099 15:100858567-100858589 AGTGAGAGCTCAGTGACTGAAGG - Intergenic
1132718043 16:1301777-1301799 AGGGTGAGGTCAGAGAGAGTGGG - Intergenic
1132723117 16:1326559-1326581 ACCGAGAGCTCAGTGACTGCAGG - Exonic
1133724954 16:8528794-8528816 AGCGCGTGCTCAGTGAGTGATGG - Intergenic
1133997428 16:10759130-10759152 AGTCAGAGCTCAGTGAGTGCTGG - Intronic
1134621389 16:15692157-15692179 AAGGAGTGCTCAGTGTGTGCTGG + Intronic
1135388862 16:22071221-22071243 AGGGAGAGCCCCGTGAGAGGAGG + Intronic
1135453037 16:22574435-22574457 ACTGAGAGCTCAATGAGGGTAGG - Intergenic
1135466838 16:22693893-22693915 AGGGAGAGCTCACTTAGACTTGG - Intergenic
1136119144 16:28118805-28118827 AGGAAGTGCTCAGTGACTGTTGG - Intronic
1137424014 16:48362057-48362079 ATGAAGAGCTCTGTGAGTTTAGG - Exonic
1138336768 16:56259569-56259591 AGGGAGAGCTCTGACACTGTCGG - Intronic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139697878 16:68688024-68688046 AGAGCATGCTCAGTGAGTGTTGG + Intronic
1142006417 16:87691475-87691497 AGGGGGCGCTCAGGGCGTGTGGG + Intronic
1142189748 16:88712446-88712468 AGGGAGAGGCCAGTGAGGCTGGG - Intronic
1142688458 17:1591213-1591235 AGGGAGTGCTCTGTGGGTATCGG - Intronic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1143088671 17:4435500-4435522 AGGGAGGGCACAGTGGGGGTGGG + Intronic
1143164540 17:4891429-4891451 AGGGAGAGACCAGGGAGGGTGGG - Intronic
1143260960 17:5597920-5597942 AGGGAGAGCTGGGTGTGTTTTGG + Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143659982 17:8318790-8318812 AGGGAGAGCTGACTGAGTTAGGG + Exonic
1144327597 17:14196790-14196812 AGGGAGGGCAAAGAGAGTGTGGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146433082 17:32817690-32817712 TGGTAACGCTCAGTGAGTGTTGG - Intronic
1146820284 17:35979206-35979228 AGGGGAAGCTCAGTGTGTCTTGG + Intronic
1147877983 17:43635105-43635127 AGACAGAGCTCAGAGAGTGGGGG + Intergenic
1147894127 17:43739432-43739454 AGGAAGAGGTCAGGGAGTGAAGG + Intergenic
1148102719 17:45102523-45102545 AGAGAAAGAGCAGTGAGTGTGGG + Intronic
1148155704 17:45424358-45424380 AGTGAGAGGTCAGTGGCTGTTGG - Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149582540 17:57761323-57761345 AGTGAATGCTCAGTGAATGTTGG - Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150575276 17:66425277-66425299 AGGGAGAGGTCTGTGGATGTTGG - Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151450660 17:74196559-74196581 AGGCAGGGCTGACTGAGTGTAGG + Intergenic
1151713929 17:75821989-75822011 AGGAAGAGCTCAGGGAGCCTTGG - Intronic
1152118859 17:78405849-78405871 CGGAAGAGCTGAGTGAGTGGGGG + Intronic
1152393496 17:80017055-80017077 AGGGAGAGCTGAGTGGATGAGGG - Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153639903 18:7148001-7148023 AGGGAGAGCCCTGTGAGCGTAGG + Intergenic
1153678374 18:7476657-7476679 AGGGGGAGGTCAGGGAGTGCAGG - Intergenic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1154260267 18:12825446-12825468 AGGAAGGGATCAGTGAGGGTGGG + Intronic
1154977326 18:21472468-21472490 TGGCAGACCTCAGTGAATGTTGG - Intronic
1155334774 18:24752426-24752448 AGGGAGGGATCAGGGCGTGTAGG + Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1157169924 18:45393802-45393824 AGTGAGAACTCAGTGAGTGTTGG - Intronic
1157307847 18:46529932-46529954 AGGGAGGGCTCAGTAAATATGGG + Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159285042 18:66337554-66337576 GGGAAGAGCTCAGTGACTGTGGG - Intergenic
1159339797 18:67119809-67119831 ACGGAAAGCTCAGTGATTGGGGG - Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1160009083 18:75090013-75090035 AGGGAGAGCACAGTCAGAGGTGG + Intergenic
1161206087 19:3042089-3042111 AGGGGGAGCGCAGGGAGCGTGGG + Intronic
1161655240 19:5510405-5510427 ACGGAGAGCTCAGAGGGTCTGGG - Intergenic
1162858421 19:13487509-13487531 AGTGAGCGCTCAGTGAGTACGGG + Intronic
1163600742 19:18247815-18247837 AGGGAGGGTGCAGAGAGTGTGGG - Intronic
1165698483 19:37919324-37919346 AGTAAGAGCTCAGTGAATGCTGG - Intronic
1165829867 19:38725156-38725178 AGTGAGTGCTCAGTGAGTGGTGG - Intronic
1166411932 19:42561242-42561264 AGCGTGAGCTCCGTGAGGGTGGG + Intergenic
1166933857 19:46319290-46319312 AGGGAGGGTTTATTGAGTGTGGG + Intronic
1167429685 19:49447333-49447355 CGGGAGAGCTGAGTCAGGGTGGG - Exonic
1168115079 19:54217854-54217876 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168120772 19:54251546-54251568 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168124350 19:54275443-54275465 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
925699059 2:6614370-6614392 ACGGAGAGTGCTGTGAGTGTGGG - Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927108731 2:19849193-19849215 AGGGAAAGCTCAGGGAATGGAGG + Intergenic
927211526 2:20641874-20641896 AGCAAGAGCTCCGTGAGTGAAGG - Intronic
927570405 2:24154005-24154027 AGGGTGAGCCCAGTGAGTAGGGG - Intronic
927966831 2:27275601-27275623 AGGGAGAGCTCTGAGTGTGCAGG - Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928693320 2:33823443-33823465 AGTAAGTGCTCAGTGAGTGTAGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
929378857 2:41324932-41324954 AGGCAGAGCTCTCTGGGTGTGGG - Intergenic
929702020 2:44170066-44170088 ATGAAGGACTCAGTGAGTGTTGG + Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
933422386 2:82066283-82066305 AGGTAGAGGTCAGTGAGTCAAGG - Intergenic
933760330 2:85668058-85668080 AAGCAGTGCTCAGTGAGTGGTGG + Intronic
934927654 2:98392681-98392703 AAGGAGAGCTCAGTCAATCTTGG + Intronic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935035649 2:99369917-99369939 AGGGAGATTTCAGTGAGCCTAGG + Intronic
936538824 2:113333652-113333674 AGAGAGCACGCAGTGAGTGTGGG - Intergenic
936641539 2:114317355-114317377 AAGGAGAGCTCAGCGACTGGGGG - Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937040956 2:118820291-118820313 AGGCAGAGGAAAGTGAGTGTGGG + Intergenic
938640186 2:133269592-133269614 AGGGAGAGGTCAATGAGGGTAGG + Intronic
938821693 2:134966876-134966898 AAGGGCAGTTCAGTGAGTGTAGG + Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940987746 2:160065121-160065143 AGGGAGGGCTCAGTGCCTGCTGG + Intergenic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942294761 2:174506952-174506974 AGAGAAAGCACAGCGAGTGTCGG + Intergenic
942542659 2:177030975-177030997 AGGGACAGCTCAATTTGTGTGGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943785525 2:191874027-191874049 AGGTAGAGCTCACTCACTGTTGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
946336665 2:219042206-219042228 GGAGAGAGCTTAGTGAGTCTAGG + Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948302838 2:236920931-236920953 TGTGAGTGCTCAGTGAGTGCTGG + Intergenic
948547580 2:238743660-238743682 AGGGAGAGGTGAGTAAGGGTTGG + Intergenic
948562162 2:238861418-238861440 AGCCAGCGCCCAGTGAGTGTAGG + Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948794714 2:240396417-240396439 AGGGAAAGCTCAGTAAATGGTGG + Intergenic
948892671 2:240915016-240915038 AGGGAGGGCGCAGGGACTGTAGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169833453 20:9851673-9851695 AGGAAGTGCTCAGTAAATGTTGG - Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170592738 20:17783298-17783320 AGACAGAGCTCGGTGAGTGAGGG - Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172045257 20:32075596-32075618 ATGGAGAGCTCCTTGAGGGTAGG - Intronic
1172220413 20:33270608-33270630 AGTAGGAGCTCAGTGAGTGCTGG - Intergenic
1172834012 20:37861200-37861222 AGCGGGTGCTCAGTCAGTGTGGG + Intronic
1172838890 20:37890201-37890223 AGGAACAGCGCAGTGAATGTGGG + Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1173789199 20:45816674-45816696 AGGCAGGTCTCAGTGAGTGATGG - Intronic
1174525478 20:51167331-51167353 AAGAACAGCTCAGTGAGTCTGGG + Intergenic
1175092016 20:56512502-56512524 ACTGACAGCTCTGTGAGTGTGGG + Intronic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176431714 21:6580081-6580103 AGGGAGGCCTCAGTGAGTCAGGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178278999 21:31264929-31264951 AGGCAGAGTTCAGGGAGTCTTGG - Intronic
1178908533 21:36655564-36655586 AGTCAGAGCTCAGGGAGTTTAGG - Intergenic
1179098470 21:38336216-38336238 GGGAAATGCTCAGTGAGTGTTGG - Intergenic
1179707108 21:43187543-43187565 AGGGAGGCCTCAGTGAGTCAGGG - Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180715677 22:17870618-17870640 AGGGACAGCTCAGCGAGGTTGGG + Intronic
1181684449 22:24518928-24518950 AGTGAGAGCCCAGTGTGTGCAGG - Intronic
1183034094 22:35127648-35127670 AGTGAGAGCTTAGTGCCTGTGGG - Intergenic
1183496428 22:38147385-38147407 AGGCAGTGCCCAGAGAGTGTTGG + Intronic
1184666375 22:45991290-45991312 ACGGAAAGCTCAGAGAGTGCTGG + Intergenic
949962388 3:9323194-9323216 AGGGACAGCACAGGGAGTTTTGG + Intronic
950672888 3:14537787-14537809 AGGGAAGTCTCAGTGGGTGTGGG - Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952192351 3:31037222-31037244 AGTGAGAGCTCAGAGAGGGGAGG + Intergenic
952247687 3:31613070-31613092 AGTAAGAGCTTAGTGAGTGTAGG + Intronic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953745633 3:45571870-45571892 TGGGAGAGTTGAGTGAGAGTTGG - Intronic
953822657 3:46221892-46221914 AGGCAGAGCTAAGTGAGGGGTGG - Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957046004 3:75375174-75375196 AAGGACAGTTCAGTGAGTGTAGG - Intergenic
957074826 3:75593695-75593717 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
961276380 3:125730436-125730458 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
961279282 3:125753017-125753039 AGGGGCAGTTCAGCGAGTGTAGG + Intergenic
961567468 3:127773954-127773976 AGGGCGAAGTCAGGGAGTGTGGG - Intronic
961866728 3:129958805-129958827 GGGGTGGGATCAGTGAGTGTAGG + Intergenic
961875118 3:130016582-130016604 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
961878057 3:130039294-130039316 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963138388 3:141928533-141928555 AGGTTGAGCTGAGGGAGTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963233060 3:142928479-142928501 AGGCAGAGCCCAGAGAGTATAGG - Intergenic
963412453 3:144947920-144947942 AGGGAGGGCTCTGTGAATGCGGG - Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963784847 3:149523879-149523901 AGAGTCAGCTCATTGAGTGTGGG - Intronic
964052482 3:152412765-152412787 AGGAAGACCACAGTTAGTGTTGG + Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965415299 3:168385161-168385183 AGGGAGAGCGCACTGAATGGGGG - Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965853942 3:173065698-173065720 AGGGAAAGTAAAGTGAGTGTGGG + Intronic
966303793 3:178508409-178508431 TTGGAAAGCTCAGTGAGAGTAGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967295103 3:187956755-187956777 AGAGAGAGCTCACTGTGTGCTGG - Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968534425 4:1114008-1114030 AGGGAGGGATAAGTGGGTGTGGG + Intergenic
968788726 4:2644221-2644243 AGGGAGAGCAAAGTGGGTGGGGG - Intronic
968990272 4:3906330-3906352 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
969018426 4:4121333-4121355 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
969023114 4:4151520-4151542 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
969172659 4:5376552-5376574 AGGTAAATCTCAGTAAGTGTTGG - Intronic
969548168 4:7845729-7845751 AGGGGGTGCTTGGTGAGTGTAGG - Intronic
969730695 4:8955563-8955585 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
969735557 4:8987385-8987407 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
969786863 4:9465192-9465214 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969790292 4:9489671-9489693 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969794777 4:9518840-9518862 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
969825051 4:9751036-9751058 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969978911 4:11133867-11133889 AGGGAGAGTTAGGTGAGTGAAGG - Intergenic
971946650 4:33287270-33287292 AGGGAGGGCTCAGTGTGAGGTGG - Intergenic
971946658 4:33287311-33287333 AGGGAGGGCTCAGTGTGAGGTGG - Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973839554 4:54846971-54846993 AGTGAGTGCTCAATGAATGTTGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974272356 4:59666927-59666949 AGGAGAAGCTCAGGGAGTGTAGG + Intergenic
974939131 4:68442644-68442666 AGGGATTCCTCAGTGAGTGAGGG + Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975516973 4:75258486-75258508 TGGGAGATCTCAGTTAATGTTGG - Intergenic
975823828 4:78299217-78299239 AAGGAGAGCTCAGTTTGTGGGGG + Intronic
975861484 4:78681901-78681923 AGGGAGAGCTAACAGAGTGATGG - Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978652872 4:111028616-111028638 AATGACAGCTCAATGAGTGTGGG - Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978735999 4:112085232-112085254 AGGGAGGGTTCAGTCAGTGATGG - Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982170762 4:152659666-152659688 AGGCAGAGATCAGTAAGTGGTGG - Intronic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982817635 4:159906374-159906396 AGTTAGAGCTCAGTGATGGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
987955970 5:24740330-24740352 AGGGAGATCTCAGGAAGTCTAGG - Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
990026953 5:51203880-51203902 AATGAGAGCTCAGTAAATGTTGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991540869 5:67726721-67726743 AGCCAGAGGTCTGTGAGTGTTGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993252514 5:85547858-85547880 AGGGAGAAGGAAGTGAGTGTAGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994287118 5:97982601-97982623 AGGGAGAGGCCATTGAATGTTGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995609320 5:113891964-113891986 AGGGAGAGCTCTTTGTGGGTTGG - Intergenic
995632633 5:114150525-114150547 AGGGTCAGCTCAGGGAATGTGGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
998317589 5:141197878-141197900 AGGCAGAGCTGAGTGAAAGTAGG - Intergenic
998529519 5:142871847-142871869 AGGGAGAGATCGGAGACTGTTGG + Intronic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999145293 5:149389020-149389042 AGGAAGAACTCAGTAAATGTCGG + Intronic
999491312 5:152054193-152054215 AGGGAGGGCTCAATTAATGTAGG - Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
999610205 5:153361274-153361296 AGAGTGAGTTCAGAGAGTGTTGG - Intergenic
999846491 5:155486674-155486696 AGTAAGAGCTCAATGAATGTTGG + Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1000608718 5:163352108-163352130 AGGGAGAACCCAGAGAATGTAGG + Intergenic
1000924406 5:167176378-167176400 AGAAAAAGCTCAGTGAGTTTTGG - Intergenic
1001568958 5:172717839-172717861 AGAGAATGCTCAGTGAGAGTGGG + Intergenic
1002022265 5:176371440-176371462 AGGGAGAGAGCATTGAGTTTAGG + Intronic
1002201357 5:177530504-177530526 AGGGAGAGATGATTGATTGTGGG - Intronic
1003007007 6:2391721-2391743 AGTGAGTGCTCAGTGACTGTGGG + Intergenic
1003448002 6:6202433-6202455 AGGAGGTGCTCAGTAAGTGTTGG + Intronic
1004218934 6:13728763-13728785 AGGAAGTGCTCAGAAAGTGTTGG - Intergenic
1005330509 6:24745434-24745456 AGGGAGATCTGTGTGTGTGTAGG + Intergenic
1006101398 6:31688329-31688351 AGGGAGAGCTCAGAGGGAGACGG + Intronic
1006979704 6:38137175-38137197 AGAGTGAGCTCAGCAAGTGTAGG + Intronic
1007673098 6:43573206-43573228 AGTCAGAGCTCAGTAAGTATTGG + Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010259286 6:73796564-73796586 AGGGGGAGCTCTGTGACAGTGGG + Intronic
1011195706 6:84777204-84777226 TGGGAGAGAGCAGTGAGTGCTGG + Intergenic
1011786429 6:90850461-90850483 ATGGAGAGCTGTGGGAGTGTCGG + Intergenic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013335443 6:109154357-109154379 AGGGAGAACTTCCTGAGTGTTGG - Intronic
1013582435 6:111549669-111549691 AATGTGAGCTCAGTGAGGGTCGG + Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016092396 6:139995912-139995934 AGGGTAAGCTCATTTAGTGTTGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017650389 6:156576169-156576191 GGGGAGAGTGAAGTGAGTGTGGG + Intergenic
1017944723 6:159086203-159086225 AGTCACAGCTTAGTGAGTGTTGG + Intergenic
1018420371 6:163635797-163635819 AGTGAGAAGTCAGGGAGTGTGGG + Intergenic
1018529238 6:164745186-164745208 CGGGAGTGCTCAGTGGGTGGGGG - Intergenic
1018737492 6:166698442-166698464 AGTGAGAGCAAAGTGAGTATAGG + Intronic
1019231936 6:170573603-170573625 AGGAATAGCTCAGTAAGTGAAGG - Intergenic
1019491289 7:1314742-1314764 GGGGAGACCCCAGCGAGTGTCGG + Intergenic
1019550215 7:1598489-1598511 AGGGCAGGCTCAGTGGGTGTCGG + Intergenic
1019844638 7:3485433-3485455 AGGGAAAGCAAAGTGAGTGTGGG - Intronic
1020310164 7:6861244-6861266 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1020313102 7:6884384-6884406 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1020428392 7:8095025-8095047 AGGGATGGCTCTGTGAGCGTGGG + Intergenic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024243504 7:47453099-47453121 TGGGAGAGCCTGGTGAGTGTGGG + Intronic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1024981315 7:55159596-55159618 GTGAAGAGCACAGTGAGTGTGGG - Intronic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026586762 7:71661783-71661805 AGGGAGAGCTGAGGGACTTTGGG + Intronic
1027360600 7:77404808-77404830 GTGTAGAGCTCAGTGAGTTTGGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1027921286 7:84399125-84399147 AGGAAAAGCACGGTGAGTGTGGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029076914 7:97942041-97942063 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1030107246 7:105997468-105997490 AAGGAGAGCTCAGTGCCTTTGGG + Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031355856 7:120785533-120785555 AGCTAGACCTCAGGGAGTGTGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1031991055 7:128199483-128199505 AGGGAGATCTCAGTTACTGCTGG + Intergenic
1033004923 7:137551292-137551314 AGAGAGAGAGCAGTAAGTGTTGG + Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035705362 8:1670564-1670586 AGGGAGTGCTCAGTAAATGTTGG + Intronic
1036240862 8:7079927-7079949 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
1036261193 8:7241664-7241686 AGAGGCAGTTCAGTGAGTGTAGG - Intergenic
1036305411 8:7597883-7597905 AGAGGCAGTTCAGTGAGTGTAGG + Intergenic
1036313232 8:7700208-7700230 AGAGGCAGTTCAGTGAGTGTAGG - Intergenic
1036356261 8:8045880-8045902 AGAGGCAGTTCAGTGAGTGTAGG + Intergenic
1036610240 8:10343586-10343608 TGGGAGAGCTTAGTGAGGGTAGG + Intronic
1036749708 8:11436065-11436087 AGGGAGCGCTCAGTAAAGGTGGG - Intronic
1037628365 8:20628699-20628721 AGGGATAGATCAGTGAGGGATGG + Intergenic
1037804096 8:22049665-22049687 AGAGAGGGCTCCGTGAGGGTAGG - Intronic
1038075327 8:24066779-24066801 AGGGGCAGCTCAGTGAATGACGG - Intergenic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1042969563 8:74393364-74393386 TGGGTGAGCTCAGTAAGTTTAGG + Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1044124165 8:88437342-88437364 AGGGAGAGCCCAGCGATTCTGGG + Intergenic
1044149320 8:88754849-88754871 AAGGACAATTCAGTGAGTGTGGG - Intergenic
1044479851 8:92672440-92672462 AGGGAGAGGACTGTGAGTTTAGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045536502 8:103033837-103033859 AGGAAGTGCCCAGTAAGTGTTGG + Intronic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1045599095 8:103693185-103693207 AGGGAGAGTTTAGTAATTGTGGG - Intronic
1046691889 8:117295106-117295128 AGTGAGGGCTCAGTGAGTGTTGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048507613 8:135035140-135035162 GGGGAGAACTCAGTGGGTGGGGG + Intergenic
1049580115 8:143407267-143407289 AAGGAGAGCTCAGTGGCTGGTGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052072048 9:24093429-24093451 AAGGCCAGCCCAGTGAGTGTGGG + Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1053056332 9:34995024-34995046 TGGCAGAGCTCAGTGAGAGAGGG - Intronic
1053310028 9:37012048-37012070 AGTGACAGCTCACTAAGTGTAGG - Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055269247 9:74537928-74537950 AGTGAGAGCTGAGTGAATGAAGG - Intronic
1056185249 9:84128429-84128451 AGGGAGAGTTGTTTGAGTGTGGG - Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058596356 9:106620090-106620112 ATGGAATGCTTAGTGAGTGTTGG - Intergenic
1058616238 9:106831014-106831036 AGGGAGAACTCAGTGATTCAGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059113163 9:111576330-111576352 AGGGAAAGCTTAGTGAGTACTGG - Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059657070 9:116366987-116367009 AGGTAGAGCTCAGTGAGCACTGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1060152505 9:121298002-121298024 AGGGAGAGCTCTCTGAATTTAGG + Intronic
1060885988 9:127152737-127152759 AGGGAAAGCTCTGTGAGGGGCGG + Intronic
1061010272 9:127950561-127950583 TGGGAGGGCTGAGGGAGTGTGGG + Intronic
1061233410 9:129328124-129328146 AGGGACAACTCAGTGGCTGTGGG + Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1061849692 9:133407131-133407153 TGGGAGGGCTCAGTCATTGTGGG - Intronic
1062311387 9:135939494-135939516 AGTGTGGGCTGAGTGAGTGTGGG - Intronic
1062703356 9:137919722-137919744 ATGGAAAGCTCAGTCCGTGTTGG + Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1187280769 X:17857228-17857250 AGGGAGACCTCAGAGAATGAGGG - Intronic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188773125 X:34179027-34179049 AGGGAGAGGGATGTGAGTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190266551 X:48830671-48830693 AGGGAGAGGGCACTGAGGGTCGG - Intergenic
1190711442 X:53073457-53073479 GAGGAGAGCTCCGGGAGTGTGGG - Intronic
1190724716 X:53181385-53181407 AGGGGAAACTCAGTGAGGGTTGG - Intergenic
1191813352 X:65216317-65216339 AGAGAGAGCGTAGTGAGTGTGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG + Intergenic
1192695442 X:73410313-73410335 TGGGGGAGCTAAGCGAGTGTTGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193750513 X:85337271-85337293 AGGGAGAGCAAGGTGAGTGTGGG - Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194086667 X:89536675-89536697 AGGGAGAGCTCAAAGAATATCGG - Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195618738 X:106932835-106932857 AGTAAGAGTTCAGTGAGTGTGGG - Intronic
1195765266 X:108289715-108289737 AGGGAGAGAGAAGTGAGTGCAGG - Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196290125 X:113930070-113930092 GGGGACAGCAAAGTGAGTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1196762706 X:119213898-119213920 AGGGAGAGGTCAGGGACAGTTGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198283172 X:135162882-135162904 AGGGAGTTCTCAGTGAATGGAGG + Intronic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198761890 X:140040932-140040954 AAGGAGAGCTCAGTGACTAGGGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199138997 X:144287957-144287979 AGGGAGAGCACAGCAAGTGAGGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199431839 X:147770667-147770689 AGAGAGAGTTCAGTGGCTGTGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199921131 X:152405166-152405188 AGGGAGAGCAAGGTGAGTATGGG + Intronic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200098289 X:153674229-153674251 AGAGGGAGCCCAGTGAGTGCCGG - Exonic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic
1201327078 Y:12773270-12773292 AGGGAGAGCTAAATCAGTATTGG + Intronic