ID: 1015464106

View in Genome Browser
Species Human (GRCh38)
Location 6:133528702-133528724
Sequence CTGTGTGGTTAGGAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 439}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015464106_1015464111 -5 Left 1015464106 6:133528702-133528724 CCCTCCTTCTCCTAACCACACAG 0: 1
1: 0
2: 1
3: 42
4: 439
Right 1015464111 6:133528720-133528742 CACAGCACAACATGCCCTTCTGG 0: 1
1: 0
2: 0
3: 18
4: 142
1015464106_1015464112 -2 Left 1015464106 6:133528702-133528724 CCCTCCTTCTCCTAACCACACAG 0: 1
1: 0
2: 1
3: 42
4: 439
Right 1015464112 6:133528723-133528745 AGCACAACATGCCCTTCTGGAGG 0: 1
1: 2
2: 0
3: 6
4: 122
1015464106_1015464115 23 Left 1015464106 6:133528702-133528724 CCCTCCTTCTCCTAACCACACAG 0: 1
1: 0
2: 1
3: 42
4: 439
Right 1015464115 6:133528748-133528770 ATCCAGTCACTCAGACCTCCTGG 0: 1
1: 0
2: 1
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015464106 Original CRISPR CTGTGTGGTTAGGAGAAGGA GGG (reversed) Intronic
900384787 1:2405456-2405478 CTGTATGGTTTGGGGAAGGGAGG + Exonic
900799912 1:4730898-4730920 CTTTGTGATTAGGGGAAAGAAGG - Intronic
900906942 1:5565867-5565889 ATGCGTGGTTAGGAGATGCAGGG - Intergenic
901028733 1:6293749-6293771 CTTTGTGGTAAGGAGAAGGAAGG - Intronic
901586473 1:10298300-10298322 CTCTGTGCTTTGGAGAAGAAGGG + Intronic
902628584 1:17691101-17691123 CTGTCTGGTTAAAAGGAGGAGGG - Intronic
902800450 1:18826338-18826360 CAGGCTGGCTAGGAGAAGGAGGG + Intergenic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903444790 1:23415529-23415551 CTGTGTGGTTATGAGAACCTTGG - Intronic
903827344 1:26155779-26155801 CTGTGTGGCTTGGAGATGCAGGG - Intergenic
904453091 1:30629096-30629118 CTGTGTTCTCAGGAGCAGGAAGG - Intergenic
904770438 1:32878237-32878259 GTGTGTGTTTGGGAGGAGGAAGG + Intergenic
905362645 1:37431086-37431108 CAGAGTGGATAGGAGAAGGAGGG + Intergenic
905772333 1:40646365-40646387 CAGAGTGGTTAGGAGCAGGCAGG + Intronic
906256975 1:44357853-44357875 CTGTGTGACAGGGAGAAGGAAGG + Intergenic
907598021 1:55737727-55737749 CTGTGCGGTTAGGAAGAGGTTGG - Intergenic
907960802 1:59278973-59278995 CTCTATGGGTAGGAGATGGAGGG + Intergenic
908028602 1:59976093-59976115 ATGTGTGGTTCGGAGAAAAAGGG - Intergenic
912524077 1:110267759-110267781 CTGTGAGGTTAGAAGCAAGATGG - Intronic
912951115 1:114121164-114121186 CTGAGATGTTAGGAGTAGGAGGG - Intronic
915460555 1:156068247-156068269 CTGGGTGGGAATGAGAAGGATGG - Intronic
916076693 1:161204283-161204305 CTGAGGGATTAGGAGAATGAGGG - Intronic
916194906 1:162213492-162213514 CTGTGTGCTTTAGAGAAAGAAGG + Intronic
916629284 1:166594299-166594321 CTGTGTTGTTAGAAGTAGCAAGG - Intergenic
916812420 1:168317147-168317169 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
916865435 1:168851388-168851410 GTGTGTGGTTAGGAATAGGGAGG + Intergenic
917081560 1:171261298-171261320 CTGTGTGTGTTGGGGAAGGAGGG - Intronic
917373714 1:174325135-174325157 CTGTATGGTTAAGTGCAGGATGG - Intronic
917450525 1:175144008-175144030 CTGGGTGGTGTGGAGAAGGGTGG + Intronic
917836050 1:178942322-178942344 CTGAGTGGTTAGGAGATGCTAGG - Intergenic
918301901 1:183212312-183212334 GTGAGTGGTCAGCAGAAGGAAGG - Intronic
918426706 1:184418012-184418034 CTGTGTGGTTAGGCAAGGGTGGG - Intronic
919758234 1:201079360-201079382 CTGGGAGGTCAGGAGCAGGAGGG - Intronic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
920400471 1:205673060-205673082 GTGTGTGGGCAGGTGAAGGATGG - Intronic
921916932 1:220623793-220623815 CTGTGTGCTTAGTAAAAGAAGGG + Intronic
922051156 1:221991795-221991817 ATGTGGGGTAAGGAGAAGGCAGG + Intergenic
924219046 1:241854635-241854657 CTGTGTAGTCAGGAGAAGAGAGG + Intronic
924657353 1:245985041-245985063 CTGTGTGGTCAGGTGAGCGATGG - Intronic
1062900132 10:1137878-1137900 CTGTGTGGTGAGGGGAGGGAAGG + Intergenic
1062917665 10:1254156-1254178 CTCTGTGGTTAGGACATGGTGGG + Intronic
1062917675 10:1254202-1254224 CTCTGTGGTTAGGATGTGGAGGG + Intronic
1062982997 10:1741121-1741143 CTGTGTGGTCAGCCGCAGGAAGG - Intergenic
1063025986 10:2178987-2179009 CTTTGTGTTAAGGTGAAGGAAGG - Intergenic
1063163539 10:3438804-3438826 CTCTGTGGTCAGCAGAAGAAAGG - Intergenic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063735461 10:8748883-8748905 ATGTGTTGATAGGGGAAGGAAGG - Intergenic
1064250006 10:13699702-13699724 CTCTGTGGTTGGGTGATGGATGG - Intronic
1067350873 10:45474454-45474476 CTGTGTGGTAGAGAGAAGGGAGG - Intronic
1067926991 10:50519644-50519666 CTGTGTGGTTTGGAAAAAGTAGG - Intronic
1068564426 10:58556913-58556935 GTGTGTGGTTAGTAGAATTATGG + Intronic
1069693365 10:70369203-70369225 GTGTGTGGGTGGGAGAAGGCGGG + Intronic
1069918924 10:71804395-71804417 CTGTGTGCTTAGAAGAAAGGGGG - Intronic
1070711902 10:78689122-78689144 CTGTGTGGGGAGGGGCAGGAGGG - Intergenic
1070740851 10:78902360-78902382 CTGTGTTGTTGGGATAAGGGTGG - Intergenic
1072774017 10:98171042-98171064 CTATGTGTTTTGGGGAAGGAAGG - Intronic
1073585851 10:104709159-104709181 CTGTGTGTTTGGGAGGAGGCGGG + Intronic
1074615783 10:115066706-115066728 AGATGTGGTGAGGAGAAGGAAGG - Intergenic
1075242828 10:120793507-120793529 CTTTGTGGAGAGGATAAGGAGGG - Intergenic
1075393575 10:122111265-122111287 CTGTATGGTTGGCAAAAGGAAGG - Intronic
1076113782 10:127881264-127881286 CTTTGTGGATAGGAGTAGGCAGG + Intronic
1076480009 10:130778765-130778787 CTGTGTGGTTGGATGAAGGTGGG + Intergenic
1076838600 10:133033539-133033561 CTGTGTGGTCTTGAGAAGGCTGG - Intergenic
1077311609 11:1891311-1891333 CTCTCTGGTTTGGGGAAGGAGGG + Intronic
1077443567 11:2579754-2579776 CTGGGTGGTCAGTAGAAGGCAGG - Intronic
1077521700 11:3039581-3039603 CTGGGTGTTTTGCAGAAGGAAGG - Intronic
1079117276 11:17647823-17647845 CCATGTGGGAAGGAGAAGGAGGG + Intergenic
1079591692 11:22191174-22191196 CTCTGAGTTTAGGATAAGGATGG - Intergenic
1080373726 11:31683071-31683093 CTTTGTGGGGAGGAGAGGGAAGG - Intronic
1081542288 11:44044625-44044647 GTGTGTGGCAAGAAGAAGGAAGG + Intergenic
1082024862 11:47564949-47564971 CTGTTTGGTCAGATGAAGGAGGG + Intronic
1082789972 11:57340403-57340425 CTGTCAGGCTAGGAGATGGATGG - Intronic
1083542941 11:63527168-63527190 CTGTGGGGTGGGGAGAAGGGGGG + Intergenic
1083792759 11:64996547-64996569 CTGGGTTATTTGGAGAAGGAAGG + Intronic
1084852723 11:71955892-71955914 CAGTGTGGGTAGGAAAAGGAAGG + Intronic
1085254825 11:75166540-75166562 GTGAGTGGGTAGGAGAGGGAAGG - Intronic
1085539904 11:77257540-77257562 GTGTGTGTGTAGGAGAGGGAGGG - Intronic
1086931235 11:92695164-92695186 CTGTCTGGTCAGAAGAAGTAAGG + Intronic
1087002236 11:93432689-93432711 CTGAATGGTTATGAGATGGACGG + Intronic
1087078166 11:94144686-94144708 CTGGGTGGAGTGGAGAAGGATGG - Intronic
1088326896 11:108609917-108609939 CTGTGTGGGATGGAGCAGGATGG + Intergenic
1088825364 11:113489460-113489482 CTGAGTCTTAAGGAGAAGGAAGG - Intergenic
1088967832 11:114742372-114742394 CTGAGTGGTTGGGAGAAGATGGG - Intergenic
1089598489 11:119598106-119598128 CTTTGTGTGTGGGAGAAGGATGG + Intergenic
1090443825 11:126746638-126746660 GGGTGTGGTTAGGTGAGGGAGGG - Intronic
1090570536 11:128039826-128039848 CTGTGTGGTTAGCAGAGTGTAGG - Intergenic
1090743375 11:129687311-129687333 CTGGGTGGTCAGGAGAAGTTAGG - Intergenic
1091054553 11:132405968-132405990 GTGTGTGTTTAGGCAAAGGAGGG + Intergenic
1091099233 11:132854876-132854898 CTGTGAGGCTAGAAGAAAGATGG - Intronic
1091274859 11:134343074-134343096 CTCTGTGGTGGGGAGGAGGAGGG - Intronic
1092056532 12:5512369-5512391 CGGTGCGGGTAGGAGAATGAGGG + Intronic
1092845641 12:12582409-12582431 CTTTGTGGTTGGGAGGAGAAAGG + Intergenic
1093701445 12:22226802-22226824 CAGAGTGGTTAGGAGAACAAAGG - Intronic
1094118797 12:26946830-26946852 CTGAGGGATTAGGAAAAGGAAGG - Intronic
1094423213 12:30294140-30294162 TCATGTGGGTAGGAGAAGGAGGG + Intergenic
1096263795 12:50108516-50108538 CTGAGGTGTAAGGAGAAGGATGG + Intronic
1096523750 12:52198639-52198661 CTGGGTGGAGAGGAGCAGGAAGG + Intergenic
1096928191 12:55172933-55172955 TTATGTAGTTAGGAGAAGGCTGG + Intergenic
1098041284 12:66356046-66356068 CTGTGTGGACACGAGAGGGAGGG + Intronic
1098361183 12:69655757-69655779 CTGTGGGATTATGAGAAGCATGG - Exonic
1099714986 12:86280070-86280092 CTATGTGCTTAGGAGAAGAATGG + Intronic
1100717150 12:97318020-97318042 CTGCGTGGTAAAGAGAAGGGGGG + Intergenic
1101716276 12:107315792-107315814 CTGGATGGTTTGGAGAAGGTAGG + Intergenic
1101748794 12:107565604-107565626 TTGTGAGGTCAGGAGATGGAGGG - Intronic
1103175366 12:118858735-118858757 GTGTGGGGTTGGGAGAAGGGAGG + Intergenic
1103578837 12:121899300-121899322 CTGAGAGGTGAGCAGAAGGAAGG - Intronic
1104399239 12:128461993-128462015 CTGTGTGTTCAGCAGAAGGTGGG + Intronic
1104653625 12:130556795-130556817 CAGTGTGGAGAGGAGCAGGAAGG + Intronic
1104694964 12:130856251-130856273 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1105792041 13:23811343-23811365 CTGAGAGGTTAGAAGCAGGATGG - Intronic
1106090755 13:26591173-26591195 CAGAGTGGTTAGGGGAGGGAAGG + Intronic
1107803461 13:44132096-44132118 CTGTCTGGTGAGGGGAAGGAGGG + Intergenic
1107996801 13:45869175-45869197 GTGTGAGGACAGGAGAAGGAAGG - Intergenic
1108116224 13:47130886-47130908 CTGTGAGGTTCTGAGAAGGAAGG - Intergenic
1109909871 13:68895347-68895369 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
1110009183 13:70310000-70310022 CTGAGTGGTTAGGATCATGAAGG + Intergenic
1110656559 13:78006804-78006826 ATGGGTGGTGAGGAGAAGGGAGG + Intergenic
1110660201 13:78051644-78051666 CAGTTTGGTTTGGAGCAGGAAGG + Intergenic
1111489923 13:88958972-88958994 CAGTGTGCTTAGGAATAGGAGGG - Intergenic
1111619719 13:90708422-90708444 CTGTGTGTGTTGTAGAAGGAGGG - Intergenic
1111629949 13:90837760-90837782 GTGTTTGATGAGGAGAAGGAAGG - Intergenic
1112107427 13:96256501-96256523 CTGTGTGGTAGGGATCAGGAAGG + Intronic
1112135247 13:96570946-96570968 GTGTGTGGATGAGAGAAGGAAGG + Intronic
1112829163 13:103427523-103427545 CTGTGTGCTTAGAAGAAGAGGGG + Intergenic
1113146274 13:107211378-107211400 TGGTGTGGTTGGGAGTAGGAGGG + Intronic
1113521571 13:110945829-110945851 CTGGGTGTTGAGGAGATGGAAGG - Intergenic
1113704299 13:112415997-112416019 CTGTGTGCTTCAGAGAGGGAGGG - Intronic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1114217773 14:20669768-20669790 CTGTGAGATTAGGACAAGCAAGG - Intergenic
1117455936 14:55896824-55896846 CTGACTGTTGAGGAGAAGGATGG - Intergenic
1117783428 14:59258077-59258099 CTGTGTGCTTTGGGGAAGGCAGG - Intronic
1119536351 14:75405764-75405786 ATGTGTGGTAAAGAGAAGCAAGG + Intergenic
1119748424 14:77060920-77060942 CTGTTTGGTGAGGTCAAGGAAGG + Intergenic
1120217797 14:81699035-81699057 CTGTGTATGTAGGAGAAGGGTGG - Intergenic
1120426604 14:84355870-84355892 CCATGTGGTGAGGAGAAGAATGG - Intergenic
1120852214 14:89181582-89181604 GCGTGTGTTTAGGAGAAGGTGGG - Intronic
1122201138 14:100123493-100123515 CAGTGTGGTTAGAGGAAGAAAGG - Intronic
1123705359 15:22947314-22947336 CTGTTCTGTGAGGAGAAGGAGGG + Intronic
1124032438 15:26023716-26023738 CTGTGAGGTTAGAAGTAGGGTGG + Intergenic
1124057939 15:26260119-26260141 CAGAGTGGTTAGCAGAAGGCAGG + Intergenic
1127058803 15:55161074-55161096 CTGTGTGGTGAGGTGAGGGAGGG + Intergenic
1127812858 15:62579667-62579689 GTCTGTAGCTAGGAGAAGGAGGG - Intronic
1127896933 15:63309301-63309323 CTGTGTGTTTAGGAGTAGTTTGG + Intergenic
1128133702 15:65247493-65247515 TTGTGTGGTTTACAGAAGGAGGG - Intronic
1128760271 15:70212065-70212087 CTGTGTGGCCATGAAAAGGAAGG + Intergenic
1131042164 15:89279812-89279834 ATGTGAGGTTGGGAGGAGGAGGG - Intronic
1131290557 15:91103128-91103150 CTCTGTGTTTAGAAGAAGGTTGG + Intronic
1132228588 15:100164564-100164586 GTGTGTGCTTAGCAGAAGCAAGG - Intronic
1132445451 15:101913104-101913126 CTGTTTGGTAAGGAGAAGTGAGG + Intergenic
1134175734 16:12004559-12004581 CTGTGTGGGAAGGAAAGGGAAGG + Intronic
1134832445 16:17334554-17334576 CTGGGTGGTTAGTAGAAAAATGG - Intronic
1135520451 16:23172838-23172860 CTGTGTGGCAAGGACCAGGAAGG + Intergenic
1135979668 16:27138180-27138202 ATGTGTGGAGAGGAGAAAGAAGG + Intergenic
1136254746 16:29030419-29030441 CTGTGTGGGCAGGAGAGAGATGG - Intergenic
1136934072 16:34442796-34442818 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1136970500 16:34969018-34969040 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
1138784354 16:59828830-59828852 CTGTGTGCTTAGGATGATGAAGG + Intergenic
1140213295 16:72987623-72987645 CTGTGTGTTTGGGAGTAGGTGGG - Intronic
1140869446 16:79093216-79093238 CGGTGTGGTTGGGAGGAGGTGGG + Intronic
1142018467 16:87765447-87765469 CTGGGTGGTGAGAAGAGGGAGGG - Intronic
1142027326 16:87821517-87821539 CTGTGAGGTGAGGAGCAAGATGG + Intergenic
1142441440 16:90100882-90100904 CTGTGTGGGCAACAGAAGGAAGG - Intergenic
1142904723 17:3034147-3034169 CTGTGGGGTGAGGGGAGGGAGGG + Exonic
1143049202 17:4109411-4109433 CTGTGTGACGAGGAGCAGGAAGG + Intronic
1143100741 17:4503412-4503434 CTGCAAGGTCAGGAGAAGGAGGG + Intronic
1144111414 17:12037947-12037969 TTTTGTTGCTAGGAGAAGGAAGG + Intronic
1144308101 17:13987498-13987520 CTGAGTGGTTAGGATAGAGATGG - Intergenic
1144523282 17:15968568-15968590 CTGTGTGGTCAGGCGGAGGAGGG + Intronic
1144992174 17:19240712-19240734 CTGTGTGGGTTGGTGAAGGTAGG - Intronic
1145036917 17:19547664-19547686 GTGTTTAGGTAGGAGAAGGATGG - Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146547244 17:33749811-33749833 CAGTGTGGATTGGAGAAAGAGGG + Intronic
1146623610 17:34419395-34419417 CTGAGAGGGTAGGAGGAGGAAGG + Intergenic
1146686161 17:34842918-34842940 CTGTGGGGCTAGGAGAGGGATGG - Intergenic
1147165329 17:38590138-38590160 ATGTGTGGATTGGAGAAGGGAGG - Intronic
1148110921 17:45144361-45144383 CTGTGTGGAGGGGAGAGGGAGGG + Intergenic
1148579575 17:48734401-48734423 CTGACTGGGTTGGAGAAGGAAGG - Intergenic
1148757109 17:49979060-49979082 TTGTGAGGTTAGGAGTAGAAGGG - Intergenic
1148778936 17:50110954-50110976 CTGTGTGCTTAGGGGAAGGGTGG - Exonic
1148847739 17:50539060-50539082 CTGAGAGGTTAGGAGCAGCAGGG - Intronic
1149171595 17:53818723-53818745 ATGTGAGGTTTGGAGAAGTATGG + Intergenic
1149309919 17:55383740-55383762 CTGTCTGTTTGGGAAAAGGATGG - Intergenic
1149626900 17:58085808-58085830 CTGTTTTTTTAGGGGAAGGAAGG + Intronic
1149888388 17:60363848-60363870 CTTTGTTTTTGGGAGAAGGAAGG + Intronic
1151085875 17:71380070-71380092 ATGTGTGGTGAGAAGAAGGGGGG + Intergenic
1151425700 17:74029786-74029808 CTGTGTGATCAGGAGAAGAAAGG + Intergenic
1151481222 17:74371007-74371029 GTGTGTGGATATGGGAAGGACGG + Intronic
1151827169 17:76529944-76529966 CAGTGTGGTCAGCAGCAGGAAGG + Intronic
1151965423 17:77428735-77428757 CTGTGGGGTCAGCAGAGGGAGGG + Intronic
1152044972 17:77929736-77929758 CTTTGGGGTCTGGAGAAGGAGGG - Intergenic
1152848562 17:82617653-82617675 CTGTGTGTCTGGGAGAGGGAAGG + Intronic
1153724688 18:7942801-7942823 CTGGGTGGGGAGGAGAAGGGAGG - Intronic
1153936313 18:9927527-9927549 CTGGGTGGTTTGGAGAATAAAGG + Intronic
1155639762 18:27999245-27999267 CTGGGGGGTTAGGTTAAGGAGGG + Intronic
1156492568 18:37505075-37505097 TTCTCTGGTTAGGAGAAGCAGGG + Intronic
1157879195 18:51304094-51304116 TTGTGTGCTTGGGAGAGGGAAGG + Intergenic
1157946804 18:51989516-51989538 ATGTGTGGAAAGGAGAAGCAAGG + Intergenic
1157959310 18:52134541-52134563 CTGTGAGGCTAGAAGCAGGATGG + Intergenic
1158110407 18:53934464-53934486 CTCTGAGGTCAGGAGAAGTAAGG - Intergenic
1158561333 18:58516264-58516286 ATATGTGGATAGGAGGAGGAAGG + Intronic
1159227134 18:65554377-65554399 CTGAGTGGTTGGGAGAAGCTGGG + Intergenic
1159575713 18:70173983-70174005 GAGTGTGGCTTGGAGAAGGAGGG + Intronic
1159902450 18:74060309-74060331 GTGTGTGGAAAGGAGAAGGTAGG - Intergenic
1162043018 19:7981802-7981824 CTGGGTGGTGAGGATGAGGAAGG + Intronic
1162504904 19:11077824-11077846 CTGTGTGATTAAGAGGAGAAAGG - Intergenic
1163005839 19:14396210-14396232 CTGTGTGGATTGGAAAAGGGAGG + Intronic
1164251194 19:23477229-23477251 TTGTGTGTTTAGCAGAATGAGGG - Intergenic
1164701077 19:30284766-30284788 ACGTGTGGTCAGGAGAAGGTGGG - Intronic
1166391031 19:42409020-42409042 CTGTGAGGTGGGGAGTAGGATGG + Intronic
1166730169 19:45054701-45054723 CTGTGGAGTTAAGGGAAGGATGG + Intronic
1168245274 19:55110003-55110025 CCGTGGGGTGAGGAGAAGGCTGG - Intronic
925778390 2:7356977-7356999 CTGTGTGGTCTGGAGAATGTTGG + Intergenic
925902094 2:8515957-8515979 CTGTGTGGGGAGGTGGAGGAGGG - Intergenic
926871470 2:17422632-17422654 CTGTGAGGTTAGAAGTAAGATGG + Intergenic
927136413 2:20099895-20099917 CTGTGTGCGCAGGAGAAGGGAGG + Intergenic
927570156 2:24152610-24152632 CTGTTTGTTTGGGAGAAGGTGGG - Intronic
927748206 2:25642221-25642243 GTGTGTTGATAGGAGAAGGCAGG + Intronic
927768281 2:25833927-25833949 CTCTGAAATTAGGAGAAGGAAGG - Intronic
927982864 2:27385580-27385602 GTATGTGGTTATGAAAAGGAGGG - Intronic
928671314 2:33606359-33606381 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
929948031 2:46384958-46384980 GTGTGTGAGAAGGAGAAGGAGGG - Exonic
930365775 2:50437593-50437615 CTGTGGGGAGAAGAGAAGGAAGG + Intronic
931874213 2:66494782-66494804 CTTTGTGGGTAGAAGAAGGAAGG + Intronic
932427552 2:71649459-71649481 CTGGGTGATAGGGAGAAGGAGGG + Intronic
932858892 2:75267695-75267717 CCGTGTGCTTGGGAAAAGGAGGG - Intergenic
932971562 2:76549501-76549523 CTTTATAGTTAGGAGAAGGAAGG + Intergenic
934041269 2:88129428-88129450 CTGTGGCTTGAGGAGAAGGAAGG - Intergenic
935156266 2:100486214-100486236 CTGTGGGGTTAGAAGCAAGATGG + Intergenic
936876156 2:117192129-117192151 CTGTGTGGGAAGGAAAGGGAAGG - Intergenic
937111847 2:119372700-119372722 CTTTGTGGGGAGGAGGAGGATGG + Intergenic
937272017 2:120659053-120659075 CTTTGTCCTTTGGAGAAGGAAGG - Intergenic
938544220 2:132313259-132313281 ATGTGTGATTAGGGGAGGGAGGG - Intergenic
939957438 2:148538805-148538827 CTGGGTGTTGAGGAAAAGGAGGG - Intergenic
941258108 2:163259196-163259218 TTGTGGGTTTAGGGGAAGGAGGG - Intergenic
942241826 2:173969611-173969633 TGATGTGGTTAGGAGAAGGTTGG + Intergenic
942672972 2:178396396-178396418 CTGTGAGGTTAGGTGGAAGAGGG - Intronic
942720248 2:178943489-178943511 CTGGGAGGTTAGGAGTAGGCAGG - Intronic
944545720 2:200797277-200797299 CTGTGTGGCTCGGCAAAGGAAGG - Intergenic
945864129 2:215158038-215158060 CTTTGTGTTTAGGACAACGACGG + Intergenic
946377016 2:219317091-219317113 CTGACTGGTTAGGAGCATGAGGG - Intergenic
946964421 2:225022505-225022527 ATGTGTGGTTAGGAGAGTGATGG - Intronic
1169100019 20:2939470-2939492 GTGTCTGGTGAGGAAAAGGAGGG + Intronic
1169244429 20:4015045-4015067 CTGGGAGGCTAGGAGGAGGATGG - Intronic
1169244843 20:4017045-4017067 CTGAGAGATTAGGAGAAGGAAGG - Intergenic
1169321288 20:4635206-4635228 GTGTGGGGTTTGGAGAAGGCAGG - Intergenic
1169400475 20:5275078-5275100 TGGTGTTGGTAGGAGAAGGAAGG + Intergenic
1169720823 20:8674504-8674526 GTCTGTGGTTATGAAAAGGATGG - Intronic
1170329578 20:15193752-15193774 CTGTGAGAGTAGGAGAATGAAGG - Intronic
1170534324 20:17324956-17324978 CTGTGTGGCAAGGAGAAGCATGG - Intronic
1171069137 20:22049415-22049437 ATGTGTGTATAGGAGAAGGATGG - Intergenic
1171873084 20:30545991-30546013 ATGTGTGATTAGGGGAGGGAGGG - Intergenic
1172675233 20:36665476-36665498 CTGGGTGGTATGGAGCAGGAAGG + Intronic
1172801276 20:37578028-37578050 GTGTGGGGTTGGGGGAAGGAAGG - Intergenic
1173610052 20:44360506-44360528 GTAGGTGGTTAGGGGAAGGATGG + Intronic
1174067823 20:47878481-47878503 GTGTGTCTTTAGGAGCAGGAAGG - Intergenic
1175399074 20:58689778-58689800 GTGTGTGGCCAGGAGGAGGAAGG - Intronic
1175582436 20:60111026-60111048 CAGTGAGGTTGGGCGAAGGAAGG + Intergenic
1175744311 20:61443527-61443549 CTGTGTGATCAGGAGAAGAAAGG - Intronic
1177538243 21:22457898-22457920 ATGTGGGGCTAGGAGAAGCATGG - Intergenic
1178991541 21:37360975-37360997 GTGTCTGGTTAAGAGGAGGAAGG + Intergenic
1180182371 21:46123725-46123747 GTGTGTGGTTAGATGATGGATGG + Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180734190 22:18003380-18003402 TTGTCTGATTATGAGAAGGAAGG - Intronic
1182327908 22:29528228-29528250 CTGGCTGGTTGGGAGAGGGAAGG - Intronic
1182867518 22:33617014-33617036 CTGTGTATTTGGGAGAGGGAAGG + Intronic
1183287350 22:36975667-36975689 CTGTGAGGTTAGAAGCAAGACGG - Intergenic
1183494609 22:38135483-38135505 CAGTGTGGTAAGGAGGTGGAGGG - Intronic
1184739707 22:46420839-46420861 CTGTGTGATAAGGTGAAGGTGGG + Intronic
1184751381 22:46488357-46488379 CTGCGGGCTTAGGAGCAGGAAGG - Intronic
1184815815 22:46868923-46868945 CTGTGTGGGTAGGAGTAGGTGGG + Intronic
949399209 3:3648002-3648024 GTGTGTGGGGAAGAGAAGGACGG + Intergenic
950419608 3:12890957-12890979 CGGTGGGGTCAGGAGAATGAGGG + Intergenic
951522098 3:23619969-23619991 CCTTGTGGTTGGGACAAGGAGGG - Intergenic
951925059 3:27900449-27900471 CTGTGTGGTTTTGACAAGGGTGG + Intergenic
954060659 3:48063986-48064008 CTGGGAGGTTAGAAGCAGGATGG - Intronic
954221730 3:49158946-49158968 CTCTGTGGCTAGGGGTAGGAGGG + Intergenic
954595936 3:51824730-51824752 CTGTGCGTTAAGGAGGAGGATGG - Intronic
957274833 3:78077418-78077440 CTGTGACGTTATGGGAAGGAAGG - Intergenic
959443871 3:106413033-106413055 CTGTGTGGTTAAGAGCAGGCGGG - Intergenic
959896590 3:111613493-111613515 CTGTGTGGTCAGGATAACGTGGG - Intronic
960147018 3:114214366-114214388 CTGTGAGGTTCGAAGCAGGAAGG + Intergenic
960280202 3:115772774-115772796 CTGTTTGGATTGGAGTAGGAGGG + Intergenic
960498318 3:118403949-118403971 CTGTGTGGTTAGAACAGAGACGG + Intergenic
961255094 3:125542999-125543021 CTGTCTGGTTAAGAGTAGAAAGG + Intronic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
963722442 3:148877920-148877942 GTGTGTGTTTTGGAGAAGGATGG + Intronic
964381633 3:156103532-156103554 CAGGGTGGTTTGGAGAATGAGGG + Intronic
964607309 3:158572210-158572232 GTGTGAGGTGAGGGGAAGGAGGG + Intronic
965180998 3:165403857-165403879 CTGTGTGCTTAAGCGAAAGAAGG + Intergenic
965200603 3:165653333-165653355 CTGTGAGGGTAGGAGCAAGATGG - Intergenic
966676125 3:182592431-182592453 CTGTGTGGCTAAGAGAACTATGG - Intergenic
967422167 3:189285387-189285409 CTGTGTGTTTTAGAGATGGAAGG + Intronic
967465943 3:189806251-189806273 CTGTGTAGCTAGAAGCAGGAGGG + Intronic
968359557 3:198137667-198137689 CTGTGTGGTCAGGAGCTGGGAGG + Intergenic
968473466 4:792216-792238 CGCTGTGGTCAGGAGCAGGAGGG + Intronic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
969233964 4:5852045-5852067 GGGTGTGGTAAGGATAAGGAAGG + Intronic
969712926 4:8854418-8854440 CTGTGTGTTTATGTCAAGGAGGG + Intronic
971128116 4:23776456-23776478 AGGTGTGGTTAGGAGAAGAGAGG + Intronic
971555129 4:28003739-28003761 CTGTGTGGTAAGTAGGAGCATGG + Intergenic
971975565 4:33681662-33681684 CTGTGAGGCTAGAAGAAAGATGG + Intergenic
973343209 4:49027279-49027301 TTGTTGGGTGAGGAGAAGGAAGG + Intronic
973800274 4:54470764-54470786 CTTTGTGGTTCTGACAAGGAAGG - Intergenic
973802610 4:54493937-54493959 CTTCTTGGTGAGGAGAAGGAAGG - Intergenic
975838920 4:78454038-78454060 ATGAGTGTCTAGGAGAAGGAAGG + Intronic
977382250 4:96290625-96290647 CTGTGTGGAAAAGTGAAGGAGGG - Intergenic
977390158 4:96399020-96399042 CTGTGTGGACAGGGGAAAGAAGG - Intergenic
977660907 4:99584862-99584884 CTGGGTGCTTTGGGGAAGGAGGG - Intronic
977696502 4:99971856-99971878 CAGTGCGGTTGGGGGAAGGATGG - Intergenic
980263658 4:130487475-130487497 CTGTGTGCTTATGTGATGGAAGG - Intergenic
980449919 4:132958187-132958209 CTGTGTCATGAGGATAAGGAGGG + Intergenic
980564277 4:134518336-134518358 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
980973145 4:139585934-139585956 TAGTATGGTAAGGAGAAGGAAGG + Intronic
982206993 4:153004295-153004317 GTGTGTGGGGAGGAGGAGGAAGG + Intergenic
982905679 4:161067236-161067258 CTTTGTGGAGAGGAAAAGGATGG - Intergenic
982960351 4:161827795-161827817 CTGTGCTGTTGGGAGAATGATGG - Intronic
983659012 4:170113342-170113364 CTGTGTGTTTAAGATAAGAAAGG + Intergenic
983872898 4:172842704-172842726 CTGGGGAGTTAGGGGAAGGAGGG + Intronic
984022927 4:174507900-174507922 CTGTGTGCCTAAGAGAAGAATGG - Intronic
984817156 4:183849420-183849442 CTGTTGGGGTGGGAGAAGGAAGG + Intergenic
985639183 5:1055599-1055621 CTGTAGGGTCAGGAGAAGGTGGG - Intronic
985660158 5:1153093-1153115 CTGTGGGGGTTGGAGGAGGATGG - Intergenic
986241487 5:5964149-5964171 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
986513645 5:8536904-8536926 CTGAGAGGTGAGGAGAAGAATGG + Intergenic
986864126 5:11965136-11965158 CTGTGTTTTTAGGAAAAGAAGGG + Intergenic
986987778 5:13518603-13518625 CTGTGTGCTCCAGAGAAGGAGGG + Intergenic
988854492 5:35214712-35214734 CTGTGAGGTTAGAAGCAAGATGG - Intronic
990260130 5:54013332-54013354 CTGTGAGGTTAGAAGCAAGATGG - Intronic
990563424 5:57005867-57005889 GTGTGTGGTTAGAAGAAAGGAGG + Intergenic
991290376 5:65028217-65028239 CTGTGTTGTCGGGAGCAGGATGG - Intergenic
992228705 5:74642360-74642382 CTGCGAGGTTAGGAGAGGGCTGG + Intronic
992657110 5:78921894-78921916 CTGTGTTCTTGGGGGAAGGAAGG + Intronic
993354755 5:86892235-86892257 TTGTGTGAGAAGGAGAAGGAAGG - Intergenic
996995131 5:129686622-129686644 CTGTGTCCTTAGGAGAAAGAAGG + Intronic
997005899 5:129815722-129815744 TTGTGAGGTTAGTAGAAGGATGG + Intergenic
997603660 5:135157246-135157268 CTGTGGAGTAAGGAGAAGGCTGG + Intronic
997750396 5:136339157-136339179 CTGTGAGGTTAGTAGCAAGATGG - Intronic
999206364 5:149851099-149851121 CTTTGCGGGCAGGAGAAGGAAGG + Exonic
999485917 5:151995597-151995619 CTGTGTGCTGACGAGAAGAATGG + Intergenic
999647301 5:153730783-153730805 CTAGGCAGTTAGGAGAAGGAAGG + Intronic
999849598 5:155523915-155523937 CTGTGTGCTTGGGAGGGGGATGG - Intergenic
999970436 5:156855759-156855781 CAGAGTAGTTAGGAAAAGGAAGG + Intergenic
1000109299 5:158092711-158092733 GTAGGTGCTTAGGAGAAGGATGG - Intergenic
1000240858 5:159406782-159406804 CTGTGAGGTTTGGTGATGGAAGG + Intergenic
1001028585 5:168245149-168245171 CTGTGAGGGTGGGAGCAGGAGGG - Intronic
1001414482 5:171535301-171535323 CTGTGGGGGCAGGAGAAGGATGG + Intergenic
1001952237 5:175824391-175824413 CTCTGGGGTTAGAAGAAGGGAGG - Intronic
1002824717 6:762549-762571 CTGCGTGGTTATGACAAGGCTGG + Intergenic
1003181737 6:3798045-3798067 TTGTGTGGTTAGGAGAGAAATGG + Intergenic
1004973926 6:20943792-20943814 CAGTGTGGTTATGACCAGGAGGG - Intronic
1005472139 6:26171952-26171974 CTCTGTGGTTAGGGCACGGAGGG - Intergenic
1005863449 6:29919041-29919063 GTGTATGGTTAGGAGTGGGAGGG - Intergenic
1006105032 6:31711284-31711306 GTGTGTGCCTAGGATAAGGAAGG - Intronic
1006881276 6:37342056-37342078 GTGTGTGGTGGGGAGAAGTAGGG - Intergenic
1007430317 6:41772689-41772711 CTGGCTGGTTGGGAGAAGGCTGG - Intronic
1007610500 6:43145870-43145892 CTGAGTGGAGAGGAGAAGGCTGG - Intronic
1008970699 6:57364576-57364598 TTCTGTGGTTAGGAGAGAGATGG + Intronic
1009159664 6:60266384-60266406 TTATGTGGTTAGGAGAGAGATGG + Intergenic
1011150720 6:84270301-84270323 CTGTGTGGTTAGGATAATATAGG + Intergenic
1011556247 6:88573792-88573814 CTGTGTGCTCTGGAGAAGGAGGG - Intergenic
1012390234 6:98729800-98729822 TTGTGTGCTCAGGAGAAAGAAGG + Intergenic
1013154581 6:107481180-107481202 CTATGGGGTTGGGAGAAGGAAGG - Intergenic
1013188902 6:107785443-107785465 CTGGGTGCTTAGGAGATGGGAGG - Intronic
1013817123 6:114111981-114112003 AAGTGAGGTTATGAGAAGGACGG - Intronic
1013945824 6:115721067-115721089 CTGTTTGTTTAGGAGAGGGAAGG - Intergenic
1014320161 6:119917983-119918005 CTGTGTTTTCAGGAGAAGGTTGG + Intergenic
1014498360 6:122155990-122156012 CTGTATGGTTAGCAGAAGTTAGG + Intergenic
1014709081 6:124785547-124785569 CTGTTTTGATGGGAGAAGGAGGG + Intronic
1015464106 6:133528702-133528724 CTGTGTGGTTAGGAGAAGGAGGG - Intronic
1015988617 6:138911948-138911970 CTTCGTGGTTGGGAGAAGGGAGG + Intronic
1016997614 6:149971180-149971202 CTCTGTGGTGTGGTGAAGGAGGG + Intronic
1017010908 6:150063518-150063540 CTCTGTGGTGTGGTGAAGGAGGG - Intronic
1017316748 6:153039758-153039780 CTGTGTGCTTACAAAAAGGAGGG - Intronic
1017967269 6:159277209-159277231 CTGTGTGGCTGGGAGAAGGGAGG + Intergenic
1018095821 6:160386287-160386309 CTTCATGGTTAGGTGAAGGAAGG + Intronic
1018381988 6:163266459-163266481 CTGTGTTGTCAGGACAGGGATGG + Intronic
1018991246 6:168675913-168675935 GTGTGGGGTTAGGGGAATGAGGG - Intergenic
1019253983 7:36864-36886 CTGTGTGGGCAACAGAAGGAAGG + Intergenic
1019260440 7:79008-79030 CTGTGTGGTCAGGAGCTGGGAGG - Intergenic
1023879899 7:44312403-44312425 CTGGGAGGGCAGGAGAAGGAGGG + Intronic
1024002672 7:45201291-45201313 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1024354774 7:48403291-48403313 CAGTGTGGTCAGAAGAAGCAAGG - Intronic
1024896816 7:54270024-54270046 ATATGTGGAGAGGAGAAGGATGG - Intergenic
1026135279 7:67654960-67654982 CTGTGTGTTTTGGTCAAGGAAGG + Intergenic
1026938789 7:74274699-74274721 GACTGTGGGTAGGAGAAGGAAGG + Intergenic
1028898829 7:96073165-96073187 GTGTGTGTTTGGGAGAAGGGAGG - Intronic
1028952599 7:96653801-96653823 CTGTGTTGTTAGGTGGAGGATGG - Intronic
1029330469 7:99849479-99849501 CTGTGTGTATAGCAGAAGGAAGG + Intronic
1031262724 7:119542728-119542750 CTGTGTGGTTAAAAGAATGAAGG + Intergenic
1033574542 7:142667758-142667780 ATGTTTGGTTAAGAGAAGGCTGG + Intergenic
1034067766 7:148153124-148153146 CTGTGAGGCTAGAAGCAGGACGG + Intronic
1034271770 7:149806566-149806588 CTGTGAGGGTAGGGGCAGGAGGG + Intergenic
1035522709 8:287849-287871 CTGTGTGGCAAGGAGACAGAAGG + Intergenic
1036803081 8:11807511-11807533 CTGTGGGGTGAGGGGAGGGAAGG + Intronic
1036967550 8:13317632-13317654 GTGTGTGGTGAGGGGAATGAGGG + Intronic
1038361813 8:26887110-26887132 TTGTGTGGCTGGGAGAAGTAAGG - Intergenic
1039285987 8:36041346-36041368 CTGTATGGTTAAAACAAGGATGG + Intergenic
1039375968 8:37034531-37034553 ATGTGTGGATAGGAGGAGAAGGG - Intergenic
1040493917 8:47949308-47949330 TTGCGTGGTTAGGAGAATAATGG - Intronic
1040494634 8:47955640-47955662 CTGAGTTGTGAGGAGAATGAAGG - Intronic
1041091910 8:54309933-54309955 CTGTGAGGGGAAGAGAAGGAAGG - Intergenic
1041848846 8:62363446-62363468 CTGTGTGTTGAGGAGAAAGGCGG - Intronic
1042070175 8:64924287-64924309 CTGTGTAGTTGGGGGAAGGAGGG + Intergenic
1042085929 8:65108733-65108755 CTATTTGGGTGGGAGAAGGATGG + Intergenic
1042948095 8:74174875-74174897 CTGTGAGGCTAGAAGCAGGATGG + Intergenic
1043226917 8:77745186-77745208 CTGTGGGCTTAGGAGAGGGAGGG + Intergenic
1043550710 8:81369389-81369411 GTGTGTGGTATGGAGAGGGAAGG - Intergenic
1043567200 8:81561624-81561646 CTGTGTGCATGGGGGAAGGAGGG + Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1046530772 8:115442595-115442617 GTGTGTGTTTGGGGGAAGGAAGG + Intronic
1046583442 8:116122335-116122357 GTGTGTGTGTAAGAGAAGGATGG + Intergenic
1046608727 8:116400716-116400738 CTGTGGTATTAGCAGAAGGATGG + Intergenic
1047734760 8:127755454-127755476 CTCTGTGGCTAGAAGAGGGAAGG - Intergenic
1048340632 8:133536166-133536188 CTCTGTGATTAGCAGAAGGTGGG + Intronic
1048609066 8:136002168-136002190 CTTTGGGGTGAGGAGATGGAGGG - Intergenic
1048766227 8:137847393-137847415 CAGTGTAGTAGGGAGAAGGAAGG - Intergenic
1048991018 8:139760183-139760205 CTCTGTGAGTAGGGGAAGGAGGG + Intronic
1049023088 8:139970988-139971010 GTGTGGGGTATGGAGAAGGAGGG - Intronic
1049073123 8:140372472-140372494 GTGTGTGGACAGGTGAAGGAAGG - Intronic
1049204117 8:141355447-141355469 CTGTGTGGCTGGGAGCAGGAGGG - Intergenic
1050323735 9:4479869-4479891 TTGTGTGGTCAAGAGAATGATGG - Intergenic
1051152442 9:14097895-14097917 CTGGTTGGTCAGGAGAGGGAGGG - Intronic
1052311109 9:27070215-27070237 CTGGGTGGGAAGGAGTAGGATGG + Intergenic
1052557998 9:30044871-30044893 CTGTGAGTTGGGGAGAAGGAGGG + Intergenic
1052887008 9:33659195-33659217 ATGTTTGGTTAAGAGAAGGCTGG + Intergenic
1053609099 9:39692855-39692877 CTGTGTGGTGTGGTGAAGGTGGG + Intergenic
1053866943 9:42449125-42449147 CTGTGTGGTGTGGTGAAGGTGGG + Intergenic
1054089217 9:60778634-60778656 CTGTGTGGTGTGGTGAAGGTGGG - Intergenic
1054176678 9:61880133-61880155 ATGTGTGGTTTGGACCAGGATGG + Intergenic
1054244426 9:62649543-62649565 CTGTGTGGTGTGGTGAAGGTGGG - Intergenic
1054558553 9:66684086-66684108 CTGTGTGGTGTGGTGAAGGTGGG - Intergenic
1054660857 9:67700673-67700695 ATGTGTGGTTTGGACCAGGATGG - Intergenic
1054753296 9:68930455-68930477 GTGGGTGGTAAGCAGAAGGAAGG - Intronic
1055157381 9:73080586-73080608 CTGTGAGGTTAAAAGAATGAAGG + Intergenic
1055475058 9:76654812-76654834 CAGTGTGGTAGGAAGAAGGAAGG - Intronic
1056478820 9:86980256-86980278 CTCTGTGGTTAGGAGGAGGGAGG + Intergenic
1056740223 9:89248083-89248105 CTGTGAGGTTGGAAGAAAGACGG + Intergenic
1056956510 9:91086008-91086030 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1057133527 9:92670694-92670716 CAGTGAATTTAGGAGAAGGAAGG - Intergenic
1057485882 9:95483750-95483772 ATGTGTGGCTAGGTGGAGGATGG - Intronic
1058360639 9:104142666-104142688 CTGTGTGGTTACAAGGAGTATGG + Intergenic
1058958108 9:109968111-109968133 CTGTGTGGTCTGAAGAAGAAAGG + Intronic
1058982345 9:110181710-110181732 CTGTGAGGTTAGGGGCAAGATGG + Intergenic
1059352302 9:113674139-113674161 CTGTCTGGTTCAGAGTAGGAAGG - Intergenic
1059570815 9:115433062-115433084 ATGTGGGGTTGGGAGAAGGGAGG + Intergenic
1060045663 9:120338163-120338185 TTGTGAGGTTAGGAGCAAGATGG + Intergenic
1061046106 9:128166022-128166044 CTGGGTGGATAGGGGAAGGGGGG - Intergenic
1061073730 9:128328082-128328104 CCTTGTGTTTAGGAAAAGGAAGG + Intronic
1061533770 9:131235040-131235062 CTGTGCAGTTAGGAGAGGGAGGG + Intergenic
1061836909 9:133335610-133335632 CGGTGTGGGGAGGAGGAGGATGG - Intronic
1062483226 9:136762101-136762123 CTGTGCTGTGAGGGGAAGGAAGG + Intronic
1062744244 9:138201381-138201403 CTGTGTGGTCAGGAGCTGGGAGG + Intergenic
1062746415 9:138215679-138215701 CTGTGTGGGCAACAGAAGGAAGG - Intergenic
1187136339 X:16551157-16551179 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1187410727 X:19048535-19048557 CTGTGGGCTGAAGAGAAGGAAGG + Intronic
1187421004 X:19133660-19133682 CTGTTGGGTTTGGGGAAGGAGGG - Intergenic
1187676310 X:21719916-21719938 CTGGGTGGTAAGGATCAGGAGGG + Intronic
1187987469 X:24829730-24829752 CTGTGTATTTAGGAGGAGGGAGG + Intronic
1188048400 X:25454487-25454509 GTGTTTGGTGAGGAGATGGAGGG - Intergenic
1188552148 X:31376179-31376201 CTGTTTTGTTAGAGGAAGGAAGG - Intronic
1188695829 X:33189563-33189585 GTGATTGGTAAGGAGAAGGAGGG + Intronic
1189699556 X:43703347-43703369 CTGTCTTGTTACGAGGAGGACGG + Intronic
1190157120 X:48003492-48003514 CGGTGAGGTGAGCAGAAGGAAGG - Exonic
1190368810 X:49722506-49722528 GTGTGTGGTGAGGGGAAGGGTGG + Intergenic
1190391299 X:49934451-49934473 CTGGGTAGTTAAGAGAAGGTAGG - Intronic
1192037956 X:67586254-67586276 TTGTGTGTTTGGGGGAAGGAGGG - Intronic
1192210274 X:69123471-69123493 CTGTGGGGTGAGGAAAAGGTGGG - Intergenic
1194263955 X:91733356-91733378 CTGGGTGGTTTGGACAAGGGAGG - Intergenic
1195244303 X:102981651-102981673 CTGGTGGGTTGGGAGAAGGAAGG + Intergenic
1196339824 X:114583527-114583549 CTTTGGGGTTAGGGAAAGGATGG + Intergenic
1197167437 X:123393092-123393114 CTTTGTGGTTATCAGAATGAAGG + Intronic
1197487853 X:127075476-127075498 CTGTGTGCTTGGGGGAGGGAGGG - Intergenic
1198963632 X:142206038-142206060 CTGTCTGGACAGGAGAAGGAAGG - Intergenic
1199847633 X:151702491-151702513 CTGTGAGGTAGGGGGAAGGATGG - Exonic
1199944747 X:152656271-152656293 GTGTGAGGTGAGGAGAGGGATGG - Exonic
1200184203 X:154171043-154171065 CTGTGTGCTGAGGAGAAGCACGG - Intergenic
1200189856 X:154208171-154208193 CTGTGTGCTGAGGAGAAGCACGG - Intergenic
1200195609 X:154245980-154246002 CTGTGTGCTGAGGAGAAGCACGG - Intergenic
1200201262 X:154283101-154283123 CTGTGTGCTGAGGAGAAGCACGG - Intronic
1200980331 Y:9258223-9258245 CTGTGCAGTTAGGAGAATGTGGG - Intergenic
1201696539 Y:16832999-16833021 CTGTGAGCCTAGGAGAAGGGGGG - Intergenic
1201771410 Y:17620412-17620434 CTGTGTGGCAAGGATCAGGAAGG + Intergenic
1201830145 Y:18285574-18285596 CTGTGTGGCAAGGATCAGGAAGG - Intergenic