ID: 1015464456

View in Genome Browser
Species Human (GRCh38)
Location 6:133533249-133533271
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015464456_1015464461 9 Left 1015464456 6:133533249-133533271 CCAAACTGGCACCTCCGTGTTTG No data
Right 1015464461 6:133533281-133533303 TGCACCCACCCACCTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015464456 Original CRISPR CAAACACGGAGGTGCCAGTT TGG (reversed) Intergenic
No off target data available for this crispr