ID: 1015466851

View in Genome Browser
Species Human (GRCh38)
Location 6:133557745-133557767
Sequence AGTTATCAGCAGAAGACGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015466847_1015466851 17 Left 1015466847 6:133557705-133557727 CCCTGGTAACAGACGAAGAGCTG No data
Right 1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG No data
1015466848_1015466851 16 Left 1015466848 6:133557706-133557728 CCTGGTAACAGACGAAGAGCTGT No data
Right 1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG No data
1015466846_1015466851 23 Left 1015466846 6:133557699-133557721 CCAAAGCCCTGGTAACAGACGAA No data
Right 1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG No data
1015466845_1015466851 26 Left 1015466845 6:133557696-133557718 CCACCAAAGCCCTGGTAACAGAC No data
Right 1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015466851 Original CRISPR AGTTATCAGCAGAAGACGGC AGG Intergenic
No off target data available for this crispr