ID: 1015467236

View in Genome Browser
Species Human (GRCh38)
Location 6:133560612-133560634
Sequence GGTTCAAAGTGTGACCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015467236_1015467240 -1 Left 1015467236 6:133560612-133560634 CCTCATGGGTCACACTTTGAACC No data
Right 1015467240 6:133560634-133560656 CTTACCTCTAGGGTCCCACCAGG No data
1015467236_1015467246 22 Left 1015467236 6:133560612-133560634 CCTCATGGGTCACACTTTGAACC No data
Right 1015467246 6:133560657-133560679 ACTTTAGTCTAGAAGGAAACAGG No data
1015467236_1015467244 15 Left 1015467236 6:133560612-133560634 CCTCATGGGTCACACTTTGAACC No data
Right 1015467244 6:133560650-133560672 CACCAGGACTTTAGTCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015467236 Original CRISPR GGTTCAAAGTGTGACCCATG AGG (reversed) Intergenic
No off target data available for this crispr