ID: 1015467239

View in Genome Browser
Species Human (GRCh38)
Location 6:133560633-133560655
Sequence CTGGTGGGACCCTAGAGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015467239_1015467246 1 Left 1015467239 6:133560633-133560655 CCTTACCTCTAGGGTCCCACCAG No data
Right 1015467246 6:133560657-133560679 ACTTTAGTCTAGAAGGAAACAGG No data
1015467239_1015467249 24 Left 1015467239 6:133560633-133560655 CCTTACCTCTAGGGTCCCACCAG No data
Right 1015467249 6:133560680-133560702 AGTGTTTGTGGTGGCTCCTGAGG No data
1015467239_1015467244 -6 Left 1015467239 6:133560633-133560655 CCTTACCTCTAGGGTCCCACCAG No data
Right 1015467244 6:133560650-133560672 CACCAGGACTTTAGTCTAGAAGG No data
1015467239_1015467247 12 Left 1015467239 6:133560633-133560655 CCTTACCTCTAGGGTCCCACCAG No data
Right 1015467247 6:133560668-133560690 GAAGGAAACAGGAGTGTTTGTGG No data
1015467239_1015467248 15 Left 1015467239 6:133560633-133560655 CCTTACCTCTAGGGTCCCACCAG No data
Right 1015467248 6:133560671-133560693 GGAAACAGGAGTGTTTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015467239 Original CRISPR CTGGTGGGACCCTAGAGGTA AGG (reversed) Intergenic
No off target data available for this crispr