ID: 1015467241

View in Genome Browser
Species Human (GRCh38)
Location 6:133560638-133560660
Sequence AAGTCCTGGTGGGACCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015467241_1015467247 7 Left 1015467241 6:133560638-133560660 CCTCTAGGGTCCCACCAGGACTT No data
Right 1015467247 6:133560668-133560690 GAAGGAAACAGGAGTGTTTGTGG No data
1015467241_1015467249 19 Left 1015467241 6:133560638-133560660 CCTCTAGGGTCCCACCAGGACTT No data
Right 1015467249 6:133560680-133560702 AGTGTTTGTGGTGGCTCCTGAGG No data
1015467241_1015467248 10 Left 1015467241 6:133560638-133560660 CCTCTAGGGTCCCACCAGGACTT No data
Right 1015467248 6:133560671-133560693 GGAAACAGGAGTGTTTGTGGTGG No data
1015467241_1015467246 -4 Left 1015467241 6:133560638-133560660 CCTCTAGGGTCCCACCAGGACTT No data
Right 1015467246 6:133560657-133560679 ACTTTAGTCTAGAAGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015467241 Original CRISPR AAGTCCTGGTGGGACCCTAG AGG (reversed) Intergenic
No off target data available for this crispr