ID: 1015467246

View in Genome Browser
Species Human (GRCh38)
Location 6:133560657-133560679
Sequence ACTTTAGTCTAGAAGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015467235_1015467246 25 Left 1015467235 6:133560609-133560631 CCTCCTCATGGGTCACACTTTGA No data
Right 1015467246 6:133560657-133560679 ACTTTAGTCTAGAAGGAAACAGG No data
1015467239_1015467246 1 Left 1015467239 6:133560633-133560655 CCTTACCTCTAGGGTCCCACCAG No data
Right 1015467246 6:133560657-133560679 ACTTTAGTCTAGAAGGAAACAGG No data
1015467236_1015467246 22 Left 1015467236 6:133560612-133560634 CCTCATGGGTCACACTTTGAACC No data
Right 1015467246 6:133560657-133560679 ACTTTAGTCTAGAAGGAAACAGG No data
1015467241_1015467246 -4 Left 1015467241 6:133560638-133560660 CCTCTAGGGTCCCACCAGGACTT No data
Right 1015467246 6:133560657-133560679 ACTTTAGTCTAGAAGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015467246 Original CRISPR ACTTTAGTCTAGAAGGAAAC AGG Intergenic
No off target data available for this crispr