ID: 1015470984

View in Genome Browser
Species Human (GRCh38)
Location 6:133606174-133606196
Sequence TAAGTTAACCAGTCCTCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015470984_1015470986 5 Left 1015470984 6:133606174-133606196 CCAATAGAGGACTGGTTAACTTA No data
Right 1015470986 6:133606202-133606224 AAACTGGTTCATCCAGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015470984 Original CRISPR TAAGTTAACCAGTCCTCTAT TGG (reversed) Intergenic
No off target data available for this crispr