ID: 1015475750

View in Genome Browser
Species Human (GRCh38)
Location 6:133657501-133657523
Sequence GACAGCTCTTGGCTTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015475745_1015475750 16 Left 1015475745 6:133657462-133657484 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 1015475750 6:133657501-133657523 GACAGCTCTTGGCTTGTTACTGG No data
1015475747_1015475750 11 Left 1015475747 6:133657467-133657489 CCATCTTCTGCAGATAACTACAC No data
Right 1015475750 6:133657501-133657523 GACAGCTCTTGGCTTGTTACTGG No data
1015475746_1015475750 15 Left 1015475746 6:133657463-133657485 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 1015475750 6:133657501-133657523 GACAGCTCTTGGCTTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015475750 Original CRISPR GACAGCTCTTGGCTTGTTAC TGG Intergenic
No off target data available for this crispr