ID: 1015476008

View in Genome Browser
Species Human (GRCh38)
Location 6:133659313-133659335
Sequence ACCCTGTGAATAAGGTCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015476004_1015476008 5 Left 1015476004 6:133659285-133659307 CCATTAAGGTGTCTCTTAGTATT No data
Right 1015476008 6:133659313-133659335 ACCCTGTGAATAAGGTCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015476008 Original CRISPR ACCCTGTGAATAAGGTCAAT GGG Intergenic
No off target data available for this crispr