ID: 1015483630

View in Genome Browser
Species Human (GRCh38)
Location 6:133743721-133743743
Sequence TAGAGCTATCAGATGAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015483630_1015483636 11 Left 1015483630 6:133743721-133743743 CCAGGTCTCATCTGATAGCTCTA No data
Right 1015483636 6:133743755-133743777 GGCCCCAGAGTTGAAGAAGATGG No data
1015483630_1015483641 23 Left 1015483630 6:133743721-133743743 CCAGGTCTCATCTGATAGCTCTA No data
Right 1015483641 6:133743767-133743789 GAAGAAGATGGAGGAGAACCTGG No data
1015483630_1015483642 27 Left 1015483630 6:133743721-133743743 CCAGGTCTCATCTGATAGCTCTA No data
Right 1015483642 6:133743771-133743793 AAGATGGAGGAGAACCTGGCAGG No data
1015483630_1015483639 14 Left 1015483630 6:133743721-133743743 CCAGGTCTCATCTGATAGCTCTA No data
Right 1015483639 6:133743758-133743780 CCCAGAGTTGAAGAAGATGGAGG No data
1015483630_1015483631 -10 Left 1015483630 6:133743721-133743743 CCAGGTCTCATCTGATAGCTCTA No data
Right 1015483631 6:133743734-133743756 GATAGCTCTAAACACCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015483630 Original CRISPR TAGAGCTATCAGATGAGACC TGG (reversed) Intergenic
No off target data available for this crispr