ID: 1015483631

View in Genome Browser
Species Human (GRCh38)
Location 6:133743734-133743756
Sequence GATAGCTCTAAACACCCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015483623_1015483631 28 Left 1015483623 6:133743683-133743705 CCTCCAAATGCAGTGGTGCAGGG No data
Right 1015483631 6:133743734-133743756 GATAGCTCTAAACACCCACCCGG No data
1015483630_1015483631 -10 Left 1015483630 6:133743721-133743743 CCAGGTCTCATCTGATAGCTCTA No data
Right 1015483631 6:133743734-133743756 GATAGCTCTAAACACCCACCCGG No data
1015483629_1015483631 3 Left 1015483629 6:133743708-133743730 CCTTCAGGAGATGCCAGGTCTCA No data
Right 1015483631 6:133743734-133743756 GATAGCTCTAAACACCCACCCGG No data
1015483626_1015483631 25 Left 1015483626 6:133743686-133743708 CCAAATGCAGTGGTGCAGGGGTC No data
Right 1015483631 6:133743734-133743756 GATAGCTCTAAACACCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015483631 Original CRISPR GATAGCTCTAAACACCCACC CGG Intergenic
No off target data available for this crispr