ID: 1015483636

View in Genome Browser
Species Human (GRCh38)
Location 6:133743755-133743777
Sequence GGCCCCAGAGTTGAAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015483629_1015483636 24 Left 1015483629 6:133743708-133743730 CCTTCAGGAGATGCCAGGTCTCA No data
Right 1015483636 6:133743755-133743777 GGCCCCAGAGTTGAAGAAGATGG No data
1015483630_1015483636 11 Left 1015483630 6:133743721-133743743 CCAGGTCTCATCTGATAGCTCTA No data
Right 1015483636 6:133743755-133743777 GGCCCCAGAGTTGAAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015483636 Original CRISPR GGCCCCAGAGTTGAAGAAGA TGG Intergenic
No off target data available for this crispr