ID: 1015483642

View in Genome Browser
Species Human (GRCh38)
Location 6:133743771-133743793
Sequence AAGATGGAGGAGAACCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015483635_1015483642 -5 Left 1015483635 6:133743753-133743775 CCGGCCCCAGAGTTGAAGAAGAT No data
Right 1015483642 6:133743771-133743793 AAGATGGAGGAGAACCTGGCAGG No data
1015483632_1015483642 0 Left 1015483632 6:133743748-133743770 CCCACCCGGCCCCAGAGTTGAAG No data
Right 1015483642 6:133743771-133743793 AAGATGGAGGAGAACCTGGCAGG No data
1015483637_1015483642 -9 Left 1015483637 6:133743757-133743779 CCCCAGAGTTGAAGAAGATGGAG No data
Right 1015483642 6:133743771-133743793 AAGATGGAGGAGAACCTGGCAGG No data
1015483634_1015483642 -4 Left 1015483634 6:133743752-133743774 CCCGGCCCCAGAGTTGAAGAAGA No data
Right 1015483642 6:133743771-133743793 AAGATGGAGGAGAACCTGGCAGG No data
1015483633_1015483642 -1 Left 1015483633 6:133743749-133743771 CCACCCGGCCCCAGAGTTGAAGA No data
Right 1015483642 6:133743771-133743793 AAGATGGAGGAGAACCTGGCAGG No data
1015483630_1015483642 27 Left 1015483630 6:133743721-133743743 CCAGGTCTCATCTGATAGCTCTA No data
Right 1015483642 6:133743771-133743793 AAGATGGAGGAGAACCTGGCAGG No data
1015483638_1015483642 -10 Left 1015483638 6:133743758-133743780 CCCAGAGTTGAAGAAGATGGAGG No data
Right 1015483642 6:133743771-133743793 AAGATGGAGGAGAACCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015483642 Original CRISPR AAGATGGAGGAGAACCTGGC AGG Intergenic
No off target data available for this crispr