ID: 1015487262

View in Genome Browser
Species Human (GRCh38)
Location 6:133787117-133787139
Sequence CCTCAAGTGCAGGACGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015487262_1015487269 -2 Left 1015487262 6:133787117-133787139 CCCTCCCCGTCCTGCACTTGAGG No data
Right 1015487269 6:133787138-133787160 GGCTCAGTACTCTGCAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015487262 Original CRISPR CCTCAAGTGCAGGACGGGGA GGG (reversed) Intergenic
No off target data available for this crispr