ID: 1015496068

View in Genome Browser
Species Human (GRCh38)
Location 6:133884582-133884604
Sequence TGTTAAATATAGTTTATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015496068_1015496069 -4 Left 1015496068 6:133884582-133884604 CCATCAATAAACTATATTTAACA No data
Right 1015496069 6:133884601-133884623 AACATATAAGTGCATTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015496068 Original CRISPR TGTTAAATATAGTTTATTGA TGG (reversed) Intergenic
No off target data available for this crispr