ID: 1015496069

View in Genome Browser
Species Human (GRCh38)
Location 6:133884601-133884623
Sequence AACATATAAGTGCATTACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015496066_1015496069 13 Left 1015496066 6:133884565-133884587 CCTGTATTGTTTTATGCCCATCA No data
Right 1015496069 6:133884601-133884623 AACATATAAGTGCATTACAGAGG No data
1015496068_1015496069 -4 Left 1015496068 6:133884582-133884604 CCATCAATAAACTATATTTAACA No data
Right 1015496069 6:133884601-133884623 AACATATAAGTGCATTACAGAGG No data
1015496067_1015496069 -3 Left 1015496067 6:133884581-133884603 CCCATCAATAAACTATATTTAAC No data
Right 1015496069 6:133884601-133884623 AACATATAAGTGCATTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015496069 Original CRISPR AACATATAAGTGCATTACAG AGG Intergenic
No off target data available for this crispr