ID: 1015496461

View in Genome Browser
Species Human (GRCh38)
Location 6:133888905-133888927
Sequence CACAGTTGGGAGAAGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015496450_1015496461 19 Left 1015496450 6:133888863-133888885 CCTTTTACAGATGGACAGAACAT No data
Right 1015496461 6:133888905-133888927 CACAGTTGGGAGAAGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015496461 Original CRISPR CACAGTTGGGAGAAGGTGGC TGG Intergenic
No off target data available for this crispr