ID: 1015496621

View in Genome Browser
Species Human (GRCh38)
Location 6:133889729-133889751
Sequence CAGCTTGGAGAGCTTGGTGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 5, 2: 7, 3: 30, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015496621_1015496626 -7 Left 1015496621 6:133889729-133889751 CCGACACCAAGCTCTCCAAGCTG 0: 1
1: 5
2: 7
3: 30
4: 223
Right 1015496626 6:133889745-133889767 CAAGCTGGACACGCTCAGGCTGG 0: 1
1: 1
2: 2
3: 18
4: 150
1015496621_1015496628 19 Left 1015496621 6:133889729-133889751 CCGACACCAAGCTCTCCAAGCTG 0: 1
1: 5
2: 7
3: 30
4: 223
Right 1015496628 6:133889771-133889793 CCAGCTACATCGCCCACTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1015496621_1015496629 29 Left 1015496621 6:133889729-133889751 CCGACACCAAGCTCTCCAAGCTG 0: 1
1: 5
2: 7
3: 30
4: 223
Right 1015496629 6:133889781-133889803 CGCCCACTTGAGGCAGATCCTGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015496621 Original CRISPR CAGCTTGGAGAGCTTGGTGT CGG (reversed) Exonic
900131128 1:1087823-1087845 CAGCGTGGAGTACTTGGGGTCGG - Intronic
900581344 1:3411402-3411424 CAGGTTGGAGAACTGCGTGTAGG - Exonic
900865573 1:5266473-5266495 CAGCTTGGGGAGCAGGGAGTTGG - Intergenic
901433732 1:9234013-9234035 CAGGTTGGGGAGCATGGTGAGGG + Intergenic
904396116 1:30223715-30223737 CAGCTTGGAGACCTAGGTGCTGG - Intergenic
904956974 1:34292756-34292778 CACCTTGGACCTCTTGGTGTTGG + Intergenic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
908698831 1:66875583-66875605 CAGCTGGGAGAGTTTGGAATTGG + Intronic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
912430583 1:109626486-109626508 CAGCCTGGAGAGCTGGGGGTGGG + Intronic
913349503 1:117842318-117842340 GAGCCTGGAGGGTTTGGTGTGGG + Intergenic
913543483 1:119843755-119843777 CAGCATCGAGAGCTGGGAGTAGG - Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
915897434 1:159823088-159823110 CTGCTTTGAGGGCGTGGTGTGGG - Intergenic
915973651 1:160371051-160371073 AATCTTGGAGAGCTTCTTGTCGG - Exonic
915996095 1:160565414-160565436 CAGGTTGTAGCGCTTGGTGGTGG + Exonic
916509934 1:165464231-165464253 CAGCAAGGAGAGCTGGGTGAAGG + Intergenic
920715413 1:208335831-208335853 CAGCTAGGAAAGCTTTGTTTTGG - Intergenic
923637261 1:235711425-235711447 CAGCTTTAAGAAGTTGGTGTTGG - Intronic
924551823 1:245085245-245085267 CAGCCTGGAAAACTTGGTTTGGG + Intronic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1064676297 10:17763652-17763674 GAGCTTGGAAAGATGGGTGTGGG + Intronic
1065312707 10:24431644-24431666 CCTCTTGGTGAGCTTGGTTTGGG - Intronic
1069261195 10:66400463-66400485 CAGCTTGAAGTGCTTAGTGTGGG - Intronic
1069357216 10:67600566-67600588 GAACTTGGTGAACTTGGTGTTGG - Intronic
1070337701 10:75469861-75469883 CAAGGTGCAGAGCTTGGTGTTGG + Intronic
1070979401 10:80632538-80632560 CAGCTTGAGGTGCTTGGAGTGGG + Intronic
1073135436 10:101217654-101217676 CAGCCTGGAGAGCCTAGTCTGGG - Intergenic
1074950494 10:118329585-118329607 CAGAGTGGAGAGCCTGGTGTGGG - Intronic
1074968958 10:118519853-118519875 TAGTTTGTAGAGCTTGGGGTAGG - Intergenic
1075653739 10:124147489-124147511 GAGCTTGGGGAGCTTGGGGTGGG - Intergenic
1076015991 10:127028025-127028047 CAGCATGGAGTGCCTGGTGGTGG + Intronic
1076084625 10:127615475-127615497 AAGCCTTGAGAGCTTGGTTTAGG + Intergenic
1076797536 10:132805552-132805574 CAGATTGGACAGCTTGTTGGGGG + Intergenic
1077178836 11:1203319-1203341 CAGCCTGGAGGGCTTGGGCTGGG + Intergenic
1077421085 11:2450334-2450356 GTGCTGGGAGAGCATGGTGTCGG + Intronic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1079243737 11:18738644-18738666 CAACTTGGAGAGATGGGGGTAGG - Intronic
1079939047 11:26655140-26655162 CAGCCTGGAAAGCTGGGGGTGGG - Intronic
1080735318 11:35008439-35008461 GATCTTGGAGAGCTTGGAGAAGG + Intronic
1081668898 11:44932554-44932576 CAGCGAGGAAAGCTCGGTGTGGG - Exonic
1081977224 11:47243254-47243276 CAGCTTGGGGAGCTGGGAGGTGG + Exonic
1082260506 11:50073695-50073717 GGGCCTGGAGAGCTTGGTTTGGG + Intergenic
1084775214 11:71370346-71370368 CACCTTGCAGTGCTTGGTCTGGG - Intergenic
1085417636 11:76329924-76329946 CAGGATGGAGAGTTTGGAGTGGG + Intergenic
1089159179 11:116424470-116424492 CAGCTGGGGGACCTTGGTCTTGG - Intergenic
1089796633 11:120986206-120986228 CAGCGAGGAGAGCCTGGAGTGGG + Exonic
1094839268 12:34336186-34336208 CAGCATGGGGGGCTTGGTGTGGG - Intergenic
1096518728 12:52172332-52172354 CAGCTGGGCCAGCTTGGTCTTGG + Exonic
1096598949 12:52715786-52715808 CAGCTTGGCGTTCTTAGTGTGGG + Intergenic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1096685582 12:53286327-53286349 AAGCTTGGAGAGCTTGGGTGAGG - Exonic
1096873210 12:54607756-54607778 GAGCTTGGAGAGCTAGGAGAGGG + Intergenic
1096917248 12:55046590-55046612 CCACTTGGAGAGCTAGGGGTTGG + Intergenic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1102761597 12:115390801-115390823 CAGGTGGGAGGGCTTGGTGCCGG - Intergenic
1102883998 12:116508270-116508292 GAGCTTGCAGAGCTTGGCGTTGG - Intergenic
1104934664 12:132358050-132358072 CAGCCGGGAGAGCTGGGTGCAGG + Intergenic
1105281187 13:18963622-18963644 CAGCTCAGAGAGCCTTGTGTGGG - Intergenic
1105290389 13:19049638-19049660 CAGCTCAGAGAGCCTTGTGTGGG - Intergenic
1107706845 13:43116380-43116402 CGGCTTGGAGAGCTGGGTCGTGG - Intergenic
1108194825 13:47982739-47982761 AAGCTTGGGGAGCTTTGGGTTGG + Intronic
1108722593 13:53147583-53147605 TAGCTTGGAAAGCGTGGTTTTGG + Intergenic
1110466949 13:75813272-75813294 CAGCTTGGAGAGTTAGCTTTTGG + Intronic
1112437014 13:99397821-99397843 AAGCTTGAAGAGCTTTGTCTAGG + Intergenic
1114528825 14:23382530-23382552 GAACTTGGACAGGTTGGTGTTGG + Exonic
1114534421 14:23413861-23413883 GAACTTGGACAGGTTGGTGTTGG + Exonic
1115694421 14:35881311-35881333 CAGCTTGGAGGCCTGGGTGGTGG - Intronic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1116458781 14:45147265-45147287 AAGCTTTGAGGGCTTGGTTTTGG - Intronic
1117505571 14:56399091-56399113 CAGCTTGGAGAGCATGTGTTTGG + Intergenic
1119753731 14:77098880-77098902 CAGCTTGCCAGGCTTGGTGTCGG + Intronic
1120549027 14:85846531-85846553 CAGGTGAGAGAGCTTGGTATGGG - Intergenic
1121979959 14:98446048-98446070 CAGCTTGGAGGGTGGGGTGTGGG + Intergenic
1122256697 14:100483400-100483422 CAGATTGGACAGGGTGGTGTGGG - Intronic
1122354839 14:101116636-101116658 GAGCTTGGAGTGCTTGGAGTGGG - Intergenic
1123032437 14:105458295-105458317 CAGGTTGGAGACCCAGGTGTGGG + Exonic
1124134569 15:27022798-27022820 CAGTGAGGAGAGCTTGGTGGAGG - Intronic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1127955166 15:63847057-63847079 CAGCATGGAGATCTTGGGGCTGG - Intergenic
1128300977 15:66566077-66566099 CAGCTGGGGGAGCTTGGCGCTGG + Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129937801 15:79465225-79465247 CAACCTTGAGAGCTTGGTGAAGG + Intronic
1130317576 15:82809747-82809769 CAGCCTGGAGGGCTGGGTGCCGG + Exonic
1131588085 15:93717711-93717733 CAGCTTGCAGAGATTTGTGAAGG - Intergenic
1131597583 15:93813644-93813666 CAGCTAGGAGAGGTGGGGGTAGG - Intergenic
1131890092 15:96963359-96963381 CATCTTGGAGAGCCTGGTGAAGG + Intergenic
1132201448 15:99957060-99957082 GAGCTGGGAGAGCTTTGAGTAGG + Intergenic
1133224096 16:4332419-4332441 GAGCCTGGAGAGCCAGGTGTGGG - Exonic
1133707315 16:8367161-8367183 CAGCATGGAGACCTTCGAGTAGG + Intergenic
1135238120 16:20777745-20777767 GAGCTTGGAGTGCTTTTTGTAGG + Intronic
1136293342 16:29288702-29288724 CATCTTGGAAGGCTTGGTGCTGG + Intergenic
1137613999 16:49836300-49836322 CAGCTTGGACAGGTTGGAGGTGG - Intronic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141813846 16:86395780-86395802 CAGCTGGGAGATCTTGGTGCTGG + Intergenic
1142018118 16:87762896-87762918 GAGGTTGGAGAGGTGGGTGTGGG - Intronic
1142423993 16:89991063-89991085 CAACTTGAATAGCTTAGTGTGGG + Intergenic
1144579334 17:16449486-16449508 GTGCCTGGAGAGCTTGCTGTGGG - Intronic
1144626518 17:16846874-16846896 CATCTTGGGGAGCCTGGAGTGGG - Intergenic
1144879914 17:18425837-18425859 CATCTTGGGGAGCCTGGAGTGGG + Intergenic
1145152319 17:20518547-20518569 CATCTTGGGGAGCCTGGAGTGGG - Intergenic
1146125604 17:30228933-30228955 CAGCATGGAGGGCTTGTTTTGGG + Intronic
1146163664 17:30572750-30572772 CATCTTGGGGAGCCTGGAGTGGG - Intergenic
1146290455 17:31602967-31602989 CACCTTGGAGAGGGTGGGGTGGG - Intergenic
1147378002 17:40034371-40034393 CTGGTTGGAGAGCTTGTTTTAGG - Intronic
1147580658 17:41625561-41625583 CATCTTGGGGAGCCTGGAGTGGG - Intergenic
1147890113 17:43711192-43711214 CTGCCTGGAGATCTTGGTGCTGG - Intergenic
1148339400 17:46864328-46864350 GAGTTGGGGGAGCTTGGTGTGGG - Intronic
1149637142 17:58180074-58180096 CAGCGTGGAGAGCATAGTGTAGG + Intergenic
1151548648 17:74808609-74808631 AAGCTTGGAGAGCTTGGGAAGGG + Intronic
1152798035 17:82317500-82317522 CGGCTGGGAGAGCTGGGTGTGGG - Exonic
1154213240 18:12397438-12397460 CAGTGTGGGGAGCTTGGTCTGGG + Intergenic
1154412427 18:14148645-14148667 CTGCTAGGAGAGCTTCGTGGAGG - Intergenic
1155439580 18:25847728-25847750 CACCTTGGAGGACTTGTTGTGGG - Intergenic
1156997853 18:43489573-43489595 CAGGTTCCAGAGCTTAGTGTAGG + Intergenic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157098367 18:44707933-44707955 CAGCAAGGAGAGATTGGTCTAGG + Intronic
1157810857 18:50694744-50694766 GAGCAAGGAGAGCTGGGTGTTGG - Intronic
1159888798 18:73935616-73935638 CTGAGTGGAGAGCTGGGTGTGGG + Intergenic
1160325407 18:77942430-77942452 CAGCTTGCACAGTTGGGTGTTGG + Intergenic
1162909348 19:13841056-13841078 CACCTTGGAAAGCTGGGTGGGGG - Intergenic
1166997557 19:46727033-46727055 CAGCTGGGAGCTTTTGGTGTGGG - Intronic
1167218621 19:48182628-48182650 CTGCTTGGAGATCTTGTTGGTGG - Exonic
925598909 2:5588236-5588258 CTACTTGGTGAGCTTGGTGCTGG + Intergenic
925835704 2:7944418-7944440 CATCTTGGAGATTTTCGTGTTGG - Intergenic
926320359 2:11745002-11745024 CTGCTTGGAGAGCTTTGTCCAGG - Intronic
926558794 2:14392521-14392543 CAGCTGTGAGACCTTGGTCTGGG - Intergenic
927461892 2:23306553-23306575 CAGCTTGGAGTGCTTTGTTATGG + Intergenic
927948253 2:27150223-27150245 CAACTTGGAGAGCTTGGTGTCGG - Exonic
928225754 2:29446606-29446628 CAGCTTGGAGATCTTGGCAGTGG - Intronic
928730352 2:34224740-34224762 GAGCTCGGAGAGTTTGGAGTAGG + Intergenic
929780678 2:44955052-44955074 CAGCTTGGCGATCTTGTTATTGG + Intergenic
932134347 2:69215157-69215179 CTACTTGGAGAGCTTGGAATGGG - Intronic
933091727 2:78127743-78127765 CAGCTGGGAATGGTTGGTGTAGG - Intergenic
933162724 2:79044290-79044312 AAGCTTGGGAAGTTTGGTGTTGG - Intergenic
933842253 2:86297263-86297285 GAGCTTGGGGACCTTGGTGCTGG + Intronic
935102083 2:100006653-100006675 GAACTTGGAGAGCTTGGCCTTGG + Exonic
937096012 2:119235673-119235695 CACCTTGAGGAGCTTGGAGTGGG + Intronic
938097620 2:128473968-128473990 TGGCCTGGAGAGCTTGGTGAGGG - Intergenic
940690006 2:156904678-156904700 CAGGTTGGACAGCTTGGATTGGG + Intergenic
940745014 2:157557377-157557399 CAGTTGGGAGACCGTGGTGTTGG + Intronic
941425527 2:165340204-165340226 CATCTTTGAGACCTTGGGGTAGG + Intronic
941769560 2:169330203-169330225 CAGCTTGGAGAGGATGGTGGGGG - Intronic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
942799044 2:179855908-179855930 CAGATTTGAGAGCTTGGGGCAGG - Intronic
943204011 2:184867518-184867540 GTGCTTGGAGAGGATGGTGTAGG + Intronic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
945541741 2:211096351-211096373 CAGCTGGCAGAGCTTGGTTCAGG + Intergenic
946182210 2:217955525-217955547 CAGCTTGGAGGGACTGGTGGTGG - Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
949028218 2:241776054-241776076 CCGTGTGGAGAGCTTGGCGTCGG + Intergenic
1172046870 20:32086631-32086653 CACCTTGGTGTGCTTGTTGTAGG - Exonic
1172129388 20:32645626-32645648 AAGCTGGGAGGGCTTGGTGCTGG - Intergenic
1173441912 20:43085285-43085307 CACCTTGTAGAGTTTGGTGTAGG - Intronic
1174610735 20:51796311-51796333 TTGCTTGGAGAGGTTGGTGGTGG - Intronic
1174642957 20:52061120-52061142 CAGCTTGTAAAGCTGGGTGGGGG + Intronic
1175543241 20:59761381-59761403 CAGCTTGGGCAGCTGGCTGTGGG - Intronic
1176545650 21:8196847-8196869 CATCTTGGAAAGCCTGCTGTTGG - Intergenic
1176564601 21:8379892-8379914 CATCTTGGAAAGCCTGCTGTTGG - Intergenic
1176860576 21:14009611-14009633 CTGCTAGGAGAGCTTCGTGGAGG + Intergenic
1179504039 21:41828266-41828288 GTGCTTGGAGAGGTTGCTGTTGG + Exonic
1179880795 21:44292606-44292628 CAGCCAGGAGAGCTGGGTTTAGG - Intronic
1181002952 22:19996441-19996463 CAGCATGGTGAGGCTGGTGTGGG + Intronic
1181360214 22:22328370-22328392 CAGCTTGCATAGCTCGGTGGTGG - Intergenic
1183121955 22:35736942-35736964 CAGCTTGGAGTGGGTGGTGGTGG + Intergenic
1184070748 22:42144769-42144791 GGGCTTGGGGAGCTTGGAGTGGG - Intergenic
1184440447 22:44509510-44509532 CAGATTGTTGAGCTTGGAGTGGG + Intergenic
1184996729 22:48212542-48212564 CTGCTTGGAGAGCTTTGTGGTGG - Intergenic
1185365854 22:50436389-50436411 CCGCTGGGAGAGCTTCGTGGAGG + Exonic
1203250521 22_KI270733v1_random:113084-113106 CATCTTGGAAAGCCTGCTGTTGG - Intergenic
949528705 3:4932291-4932313 CAGGTTTGAGAGCCTGGTCTTGG + Intergenic
949689392 3:6618113-6618135 CATCGTGAAGAGCTTGCTGTTGG + Intergenic
950651972 3:14412944-14412966 CACCTTGGAAAGGTTGCTGTTGG + Intronic
951062706 3:18228445-18228467 CAGCTTGGAAAGATTGTTGAGGG - Intronic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
953192578 3:40701472-40701494 CTGCTTGGTGAGCTTGGCTTTGG + Intergenic
953793854 3:45967983-45968005 CAGCCTGGAGCGCCTGGTGAAGG - Exonic
953983474 3:47424525-47424547 TAGCTGGTAGAGCTTTGTGTAGG - Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
956307330 3:67840030-67840052 CAGCTTGGAGAACATGTTTTGGG - Intergenic
957144314 3:76403507-76403529 CATTTTGGAGAACTTGGTCTGGG - Intronic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
958781749 3:98551278-98551300 CAGCTTGCTGGGCTTGGTGTAGG + Intronic
959573360 3:107909013-107909035 AGGCTTGGGGAACTTGGTGTGGG - Intergenic
959641490 3:108642643-108642665 CAGCAAGCAGCGCTTGGTGTAGG + Intronic
961077899 3:123998689-123998711 CAGGCTGGAGAGCTTGCTATGGG - Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
963769755 3:149378204-149378226 CATCCTGCAGAGCTTGCTGTAGG - Intergenic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
965924552 3:173961344-173961366 CATCTAGCAGAGCTTGGTTTTGG + Intronic
966391156 3:179453487-179453509 AAGCTTTGAGAGCTGGTTGTTGG + Intergenic
973714159 4:53658336-53658358 CAGATTTGAGAGCTGGATGTTGG - Intronic
976077859 4:81320027-81320049 TAGCTTGCAGAGCTTTGTGCAGG - Intergenic
976612857 4:87047548-87047570 CAGTTTGGTGAGCTTGGCTTTGG - Exonic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
978503172 4:109431124-109431146 TTGCCTGGAGAGCTTGCTGTAGG + Intergenic
979737412 4:124104589-124104611 CAGTATGGAGATCTTGGTGCAGG - Intergenic
983683068 4:170374700-170374722 CACCTTGGAGAACTTGGTCATGG + Intergenic
983940075 4:173528876-173528898 GATTTTGGAGAGTTTGGTGTCGG + Exonic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
992134942 5:73734936-73734958 CAGCTTGGAGAACTTGAGGAGGG + Intronic
992482594 5:77166784-77166806 GAGGTTTGCGAGCTTGGTGTGGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995264347 5:110140047-110140069 CATCTTGGAGAAATTGGTTTGGG + Intergenic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
999240315 5:150124000-150124022 CAGCTTCCAGACCATGGTGTTGG - Intronic
999731152 5:154477610-154477632 GATCTTGGAGAGCTTGGTGTCGG + Exonic
1000135341 5:158343292-158343314 TAGCTAGGAGAACTTTGTGTGGG - Intergenic
1001985881 5:176074209-176074231 CAGCTTGGAGTGTTTGGACTCGG - Intronic
1002264349 5:178019833-178019855 CAGCTTGGAGTGTTTGGACTCGG - Intronic
1002662262 5:180799471-180799493 CAGCGTGGAGAGAGTGCTGTGGG - Intronic
1002779578 6:356180-356202 CAGTTTTTAGAGCTTGATGTTGG + Intergenic
1003570351 6:7252505-7252527 CAGAGTGGAGATCTTGGTGTTGG + Intergenic
1003950040 6:11108489-11108511 GAGCATGGAGAGCTGGGGGTGGG + Intronic
1004049643 6:12063640-12063662 CAGCTTGGAGAGGTTTTTGGAGG + Intronic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1005996978 6:30937405-30937427 CAGCTTGCAGGGCTTGTTGCAGG + Intergenic
1007277552 6:40686322-40686344 AAGTTTGGAGAGCCTAGTGTGGG + Intergenic
1008480227 6:51978203-51978225 TGGCTTGGAAACCTTGGTGTGGG - Intronic
1008708464 6:54193810-54193832 CAGCTAGGAAAGCTTTGTGAAGG - Intronic
1009497845 6:64373550-64373572 TAGCAAGGAGAGGTTGGTGTGGG + Intronic
1013175851 6:107675770-107675792 CAGCTTGAAGAGCTGGATGCAGG + Intergenic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1016277384 6:142370753-142370775 CAGCTTTCAGAGCTAGGTTTGGG - Exonic
1016894874 6:149041783-149041805 CAGCATGGAGAGGGTGGTCTAGG - Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019820769 7:3241186-3241208 CATCTGCGAGAGCTTGCTGTGGG + Intergenic
1019952463 7:4384663-4384685 GAGCTTGGAGAGCTTTGGGAGGG + Intergenic
1026273344 7:68855268-68855290 CAAATTGGAGAGATTGGTATTGG - Intergenic
1030454941 7:109761055-109761077 GAGCCCGGAGAGTTTGGTGTGGG - Intergenic
1033247116 7:139726934-139726956 CAGCTAGAAGGGCTTGGTTTGGG + Intronic
1033602145 7:142896220-142896242 CTGATTAGAGAGCCTGGTGTAGG - Intergenic
1033648401 7:143322036-143322058 CAGCTTGGGGAGCTTGGAGCAGG + Intronic
1034129874 7:148705796-148705818 GAACTTGGAGACTTTGGTGTGGG + Intronic
1034487633 7:151375968-151375990 CAGCTTGGACAGCCTCGGGTGGG + Intronic
1034818653 7:154196777-154196799 CAGCCTGGGGAGCTTGGCCTCGG - Intronic
1038623122 8:29163783-29163805 CATCTTGGGGAGCTTAGTGTTGG - Intronic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042039320 8:64576212-64576234 CAGCTGAGGGAGCTAGGTGTGGG - Intergenic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1042722867 8:71843741-71843763 CAGCTTGGAGAGCTTAGTGTCGG + Exonic
1043864382 8:85358818-85358840 CTGCTTGGAGAGCAAGGTGCTGG + Intronic
1045385286 8:101666652-101666674 CAACATGGAGAGCATGGTGGAGG + Exonic
1048993825 8:139776706-139776728 TGGCTTCAAGAGCTTGGTGTAGG + Intronic
1049746928 8:144266933-144266955 AATCTTGGAGAGCTTGCGGTCGG - Exonic
1052169856 9:25379727-25379749 CACCTTGGACAGCTTGGTAAAGG + Intergenic
1056094249 9:83234737-83234759 AAGATTGGAAAGCTTGGAGTAGG - Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1058302866 9:103398359-103398381 CATCTTGGAGAGCCTGGTTATGG - Intergenic
1203466923 Un_GL000220v1:96356-96378 CATCTTGGAAAGCCTGCTGTTGG - Intergenic
1185504885 X:624596-624618 GAGCTTGGTGAGCTCGGTTTTGG + Exonic
1187279293 X:17845539-17845561 CAAAGTGGAGAGCTTGGAGTAGG - Intronic
1188366207 X:29318022-29318044 TATCTTGGAGAGCTGGGTGCTGG - Intronic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1191810785 X:65186087-65186109 CACCTTGGGTAGCTTGGAGTTGG + Intergenic
1191979961 X:66914558-66914580 CTGCTTGGAAAGCTTGTTTTTGG + Intergenic
1194981040 X:100440715-100440737 CAGCTTGGTGCCCTAGGTGTAGG - Intergenic
1195616472 X:106916432-106916454 CAGTTTGGAGAGCTAGGTAGGGG + Intronic
1198073646 X:133174088-133174110 AAGCCTGGAGAACTTGGTGAAGG + Intergenic
1201791224 Y:17842363-17842385 CAGCTTGGAGCGGATGTTGTGGG - Intergenic
1201810330 Y:18063626-18063648 CAGCTTGGAGCGGATGTTGTGGG + Intergenic
1202352839 Y:24012011-24012033 CAGCTTGGAGTGGATGTTGTGGG - Intergenic
1202517940 Y:25658104-25658126 CAGCTTGGAGTGGATGTTGTGGG + Intergenic