ID: 1015496931

View in Genome Browser
Species Human (GRCh38)
Location 6:133891821-133891843
Sequence GGGAAAGGCGCGCTCCCGGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 786
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 769}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015496919_1015496931 9 Left 1015496919 6:133891789-133891811 CCACCGCGTCCTGACCTTGGAGG 0: 1
1: 0
2: 2
3: 6
4: 106
Right 1015496931 6:133891821-133891843 GGGAAAGGCGCGCTCCCGGGGGG 0: 1
1: 0
2: 0
3: 16
4: 769
1015496921_1015496931 6 Left 1015496921 6:133891792-133891814 CCGCGTCCTGACCTTGGAGGTGC 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1015496931 6:133891821-133891843 GGGAAAGGCGCGCTCCCGGGGGG 0: 1
1: 0
2: 0
3: 16
4: 769
1015496916_1015496931 30 Left 1015496916 6:133891768-133891790 CCGCGAGCCGCTTATGTGGAACC 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1015496931 6:133891821-133891843 GGGAAAGGCGCGCTCCCGGGGGG 0: 1
1: 0
2: 0
3: 16
4: 769
1015496917_1015496931 23 Left 1015496917 6:133891775-133891797 CCGCTTATGTGGAACCACCGCGT 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1015496931 6:133891821-133891843 GGGAAAGGCGCGCTCCCGGGGGG 0: 1
1: 0
2: 0
3: 16
4: 769
1015496922_1015496931 0 Left 1015496922 6:133891798-133891820 CCTGACCTTGGAGGTGCGAGTCT 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1015496931 6:133891821-133891843 GGGAAAGGCGCGCTCCCGGGGGG 0: 1
1: 0
2: 0
3: 16
4: 769
1015496925_1015496931 -5 Left 1015496925 6:133891803-133891825 CCTTGGAGGTGCGAGTCTGGGAA 0: 1
1: 0
2: 3
3: 11
4: 149
Right 1015496931 6:133891821-133891843 GGGAAAGGCGCGCTCCCGGGGGG 0: 1
1: 0
2: 0
3: 16
4: 769

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015496931 Original CRISPR GGGAAAGGCGCGCTCCCGGG GGG Exonic