ID: 1015498499

View in Genome Browser
Species Human (GRCh38)
Location 6:133906365-133906387
Sequence TGAGCTCTGTTTACAACTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015498497_1015498499 18 Left 1015498497 6:133906324-133906346 CCTTGATTTGCATGGACTCAGAA No data
Right 1015498499 6:133906365-133906387 TGAGCTCTGTTTACAACTAGAGG No data
1015498498_1015498499 -7 Left 1015498498 6:133906349-133906371 CCTGTGAGAAATAACTTGAGCTC No data
Right 1015498499 6:133906365-133906387 TGAGCTCTGTTTACAACTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015498499 Original CRISPR TGAGCTCTGTTTACAACTAG AGG Intergenic
No off target data available for this crispr