ID: 1015498927

View in Genome Browser
Species Human (GRCh38)
Location 6:133910031-133910053
Sequence GGTGTCACTGGAGGACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015498917_1015498927 -2 Left 1015498917 6:133910010-133910032 CCCTTGTCTACCCCACCCTCAGG No data
Right 1015498927 6:133910031-133910053 GGTGTCACTGGAGGACAAGCAGG No data
1015498916_1015498927 2 Left 1015498916 6:133910006-133910028 CCTACCCTTGTCTACCCCACCCT No data
Right 1015498927 6:133910031-133910053 GGTGTCACTGGAGGACAAGCAGG No data
1015498919_1015498927 -3 Left 1015498919 6:133910011-133910033 CCTTGTCTACCCCACCCTCAGGT No data
Right 1015498927 6:133910031-133910053 GGTGTCACTGGAGGACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015498927 Original CRISPR GGTGTCACTGGAGGACAAGC AGG Intergenic
No off target data available for this crispr