ID: 1015502622

View in Genome Browser
Species Human (GRCh38)
Location 6:133950204-133950226
Sequence CTAGGCCAGTTCTACATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015502619_1015502622 -10 Left 1015502619 6:133950191-133950213 CCCACTTCCTTTACTAGGCCAGT No data
Right 1015502622 6:133950204-133950226 CTAGGCCAGTTCTACATTTTAGG No data
1015502616_1015502622 0 Left 1015502616 6:133950181-133950203 CCTCACTGTCCCCACTTCCTTTA No data
Right 1015502622 6:133950204-133950226 CTAGGCCAGTTCTACATTTTAGG No data
1015502614_1015502622 21 Left 1015502614 6:133950160-133950182 CCAAGCCTGGGATGGATGACTCC No data
Right 1015502622 6:133950204-133950226 CTAGGCCAGTTCTACATTTTAGG No data
1015502615_1015502622 16 Left 1015502615 6:133950165-133950187 CCTGGGATGGATGACTCCTCACT No data
Right 1015502622 6:133950204-133950226 CTAGGCCAGTTCTACATTTTAGG No data
1015502618_1015502622 -9 Left 1015502618 6:133950190-133950212 CCCCACTTCCTTTACTAGGCCAG No data
Right 1015502622 6:133950204-133950226 CTAGGCCAGTTCTACATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015502622 Original CRISPR CTAGGCCAGTTCTACATTTT AGG Intergenic
No off target data available for this crispr