ID: 1015503033

View in Genome Browser
Species Human (GRCh38)
Location 6:133953032-133953054
Sequence TTGGGGACCAGGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 912
Summary {0: 1, 1: 0, 2: 9, 3: 94, 4: 808}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015503014_1015503033 17 Left 1015503014 6:133952992-133953014 CCTCCCACCGAGCCCAGCGGGTG 0: 1
1: 0
2: 0
3: 7
4: 186
Right 1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG 0: 1
1: 0
2: 9
3: 94
4: 808
1015503025_1015503033 4 Left 1015503025 6:133953005-133953027 CCAGCGGGTGGGCAGGAGGGGCC 0: 1
1: 0
2: 3
3: 39
4: 424
Right 1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG 0: 1
1: 0
2: 9
3: 94
4: 808
1015503020_1015503033 10 Left 1015503020 6:133952999-133953021 CCGAGCCCAGCGGGTGGGCAGGA 0: 1
1: 0
2: 0
3: 24
4: 241
Right 1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG 0: 1
1: 0
2: 9
3: 94
4: 808
1015503018_1015503033 13 Left 1015503018 6:133952996-133953018 CCACCGAGCCCAGCGGGTGGGCA 0: 1
1: 0
2: 1
3: 14
4: 173
Right 1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG 0: 1
1: 0
2: 9
3: 94
4: 808
1015503024_1015503033 5 Left 1015503024 6:133953004-133953026 CCCAGCGGGTGGGCAGGAGGGGC 0: 1
1: 0
2: 1
3: 44
4: 292
Right 1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG 0: 1
1: 0
2: 9
3: 94
4: 808
1015503011_1015503033 24 Left 1015503011 6:133952985-133953007 CCTCTTACCTCCCACCGAGCCCA 0: 1
1: 1
2: 3
3: 48
4: 681
Right 1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG 0: 1
1: 0
2: 9
3: 94
4: 808
1015503010_1015503033 27 Left 1015503010 6:133952982-133953004 CCACCTCTTACCTCCCACCGAGC 0: 1
1: 0
2: 0
3: 26
4: 307
Right 1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG 0: 1
1: 0
2: 9
3: 94
4: 808
1015503009_1015503033 28 Left 1015503009 6:133952981-133953003 CCCACCTCTTACCTCCCACCGAG 0: 1
1: 0
2: 0
3: 16
4: 198
Right 1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG 0: 1
1: 0
2: 9
3: 94
4: 808
1015503017_1015503033 14 Left 1015503017 6:133952995-133953017 CCCACCGAGCCCAGCGGGTGGGC 0: 1
1: 0
2: 1
3: 7
4: 108
Right 1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG 0: 1
1: 0
2: 9
3: 94
4: 808

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015503033 Original CRISPR TTGGGGACCAGGAAGGAGGA AGG Intronic
900145593 1:1157561-1157583 GTGTGGAGCAGGAAGGGGGAAGG + Intergenic
900151212 1:1180054-1180076 ATGGGGAGCAGCCAGGAGGAGGG + Exonic
900203710 1:1422163-1422185 TTGGGGACCTGGGAGGCTGAAGG - Intergenic
900287480 1:1908600-1908622 TTTGGGAGCTGGAAGGAGGCGGG + Intergenic
900362072 1:2293922-2293944 TGGGGGTCCAGGCAGCAGGATGG + Intronic
900465806 1:2824975-2824997 AGGGGGTCCAGGAAGGAGGTGGG + Intergenic
900540628 1:3200928-3200950 AAGAGGAGCAGGAAGGAGGAAGG + Intronic
900552060 1:3261772-3261794 GTGGGGACCAGGACGGAGGGCGG - Intronic
900611468 1:3546369-3546391 TTGGGGGCCATGCAGGAGGAAGG - Intronic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
901060956 1:6471706-6471728 TGAGGTACCAGGAAGGAGGGCGG - Intronic
901501866 1:9657514-9657536 TTGGGGAACGGAAAGCAGGAAGG - Intronic
901860277 1:12069974-12069996 TAGAGGAACAGGAAGGAGGCCGG + Intronic
901919729 1:12527650-12527672 GTGTCGGCCAGGAAGGAGGAAGG - Intergenic
902618197 1:17635309-17635331 AGGGGGCCCAGGTAGGAGGAGGG - Intronic
902665595 1:17935516-17935538 TTGGGGACCAGGTAGGATCTAGG + Intergenic
902678209 1:18023755-18023777 TTGGGGAAAAGGTGGGAGGAAGG + Intergenic
902749738 1:18499451-18499473 ATGGGGACCTGGAAAGGGGAAGG - Intergenic
902781916 1:18710463-18710485 CCAGGGACGAGGAAGGAGGAGGG + Intronic
903003023 1:20279822-20279844 ATGTGGGCCAGGAAGGAGGCTGG + Intergenic
903235301 1:21946530-21946552 TTGGGGACTTGGTAGGGGGAAGG + Intergenic
903323448 1:22556011-22556033 ATGGGGATCAGGCAGGAGGGGGG - Intergenic
903350516 1:22713728-22713750 GAGGAGACAAGGAAGGAGGAAGG - Intronic
903753678 1:25646188-25646210 GCGGGGACCAGCACGGAGGAAGG - Intronic
903947397 1:26972329-26972351 TTGGGGAATAGGAAGGAGGCTGG + Intergenic
904466823 1:30713102-30713124 TTGGGGACCAGGGAAAAGGATGG - Exonic
904526306 1:31136395-31136417 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
904696421 1:32334310-32334332 GTGGGGACAGGGAAGGAGGTAGG + Exonic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905338326 1:37260558-37260580 GTGGGGGCCAGGCAGGAGGTTGG - Intergenic
905465315 1:38148759-38148781 TTGGGGACGAGGTATGTGGATGG + Intergenic
905671308 1:39792131-39792153 TTGGGGACCAGCAAGGCACAAGG + Intergenic
905703232 1:40035149-40035171 TAAGGGACAAGGAAAGAGGAAGG - Intergenic
905878057 1:41445979-41446001 TTGGGGATCTTGAAGGGGGAAGG - Intergenic
906128226 1:43440651-43440673 TGGGGGACTGGGAAGCAGGAGGG - Intronic
906244670 1:44264586-44264608 TGGGGGCTCAGGAAGGAGGGAGG - Intronic
906615062 1:47228368-47228390 TTGGGGAGAATGAAGGAGGAGGG + Intronic
906860497 1:49353882-49353904 TTGGGGAGCTGGAAAGAGGATGG - Intronic
906879752 1:49577110-49577132 TTGGGGACAAGGTATGTGGATGG + Intronic
907319337 1:53592973-53592995 GTAGGGGCCAGGAAGGAGGCAGG - Intronic
907814340 1:57903503-57903525 TTGGGGAGAAAGAAGGTGGAAGG - Intronic
908723290 1:67148690-67148712 TGGGGGACAGGGAAGCAGGAAGG - Intronic
909086447 1:71174281-71174303 GTGGGGAGCTGGAAGGAGGATGG + Intergenic
910520854 1:88120731-88120753 TGGGGAATCAGAAAGGAGGATGG + Intergenic
910561984 1:88600626-88600648 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
910567109 1:88656644-88656666 CTGTGGACCAACAAGGAGGAAGG + Intergenic
910738487 1:90489193-90489215 TTGGAGACTTGGAGGGAGGAGGG - Intergenic
910840680 1:91558426-91558448 TTGGGGAGGGGGAAGGGGGATGG - Intergenic
910846797 1:91611922-91611944 ATGGGGGCAAGGAGGGAGGAGGG + Intergenic
910901302 1:92124032-92124054 TTGGGGACCATCAAAGAGGAGGG - Intronic
911043065 1:93607287-93607309 ATGGGGACCAGGAATGAGCATGG + Intronic
911305515 1:96227222-96227244 TTGGAGGGCAGGAATGAGGAAGG - Intergenic
911643191 1:100310837-100310859 TTGGGGACCCTAAAGGAGGGGGG + Intergenic
912433347 1:109641418-109641440 TGGAGGAGCAGGAAGGAGGAAGG + Intergenic
912757069 1:112333388-112333410 TTGGGGAGAAGGAAAGTGGAAGG - Intergenic
912897363 1:113606452-113606474 TTAGGGACCAGGAAAAAGAATGG - Intronic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913380703 1:118207437-118207459 TGGGGGAACAGAAAGAAGGATGG + Intergenic
913481674 1:119294774-119294796 TTGGAGAACAGGCAGGAGGGTGG - Intergenic
915098202 1:153478987-153479009 CTGGAGACTAGGGAGGAGGAAGG - Intergenic
915580115 1:156808516-156808538 TGGGGCACCAGCAAGGAGGGAGG + Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916346546 1:163798050-163798072 TTGAAGAACAGGAAGGAAGAAGG - Intergenic
916930715 1:169575716-169575738 TTGGGGAGCTGGGTGGAGGAGGG + Intronic
916951576 1:169785489-169785511 ATGGGGAGCTGGAAGGGGGATGG + Intronic
917089513 1:171338517-171338539 TTGAGGAACAGGTAGGAGGCTGG - Intronic
917737624 1:177934967-177934989 GTGGGGAGCAGTAGGGAGGAGGG - Intronic
918125612 1:181580790-181580812 GTGGGGACCTGGAAGGAGGAGGG + Intronic
918248817 1:182684078-182684100 TTAGGGTTGAGGAAGGAGGATGG + Intronic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919162793 1:193853386-193853408 GAGGGGAGCAGGAAAGAGGATGG - Intergenic
919810019 1:201403090-201403112 TTGCTGAGTAGGAAGGAGGAGGG + Intergenic
919861233 1:201740475-201740497 CTGGGGACCAGGCGGGTGGAAGG + Intronic
920073610 1:203321237-203321259 TAGGGGACGAGGGAGGAAGAAGG + Intergenic
920170599 1:204070087-204070109 CTGGAGACCAGGATGGAGGAGGG + Intergenic
920364601 1:205441397-205441419 TTGGGGAACAGGAAGCAAGCTGG + Intronic
921185375 1:212665531-212665553 CAGGGGGCGAGGAAGGAGGAGGG - Intergenic
921294363 1:213688231-213688253 TTGGGGAGAAGGAAGTGGGAGGG - Intergenic
921773752 1:219073096-219073118 TTGGAGACTTGGAAGGTGGAAGG - Intergenic
922468317 1:225860019-225860041 CTGGGGTACAGGAAGGAGGAAGG + Intronic
922471327 1:225879192-225879214 TGTGGGGACAGGAAGGAGGAGGG - Intronic
922729495 1:227942345-227942367 GTGCAGAGCAGGAAGGAGGAAGG + Intronic
923086879 1:230708953-230708975 TTTGGGGCAAGGAACGAGGATGG - Intronic
923117702 1:230958888-230958910 TTGGGGCTGAGGCAGGAGGATGG + Intronic
923267372 1:232327768-232327790 TTGGGGAACAATAAGGAGGGAGG - Intergenic
924142288 1:241037952-241037974 TTGGGGACATGGGAGGAGGTGGG + Intronic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063371066 10:5523511-5523533 TTGGGCAGGAGGAAGCAGGAAGG - Intergenic
1063440794 10:6071423-6071445 TGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1063518552 10:6720322-6720344 TTGGAGACTAGGAAGGACGAAGG - Intergenic
1063906430 10:10784493-10784515 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1064134867 10:12741852-12741874 TTTGGGACAAGGAGGGAGGATGG + Intronic
1065270302 10:24024301-24024323 TTTAGGACCAGGATGGATGAAGG - Intronic
1065495137 10:26319801-26319823 ATGGGGACCAGAAGTGAGGAGGG + Intergenic
1065534062 10:26700496-26700518 TTGGGGACCAGGGAGGGTCAAGG + Intronic
1065971472 10:30809434-30809456 GTGGGGACCAAGAAGGACAAGGG - Intergenic
1066360981 10:34730542-34730564 GGGAGGCCCAGGAAGGAGGATGG + Intronic
1067144109 10:43681357-43681379 TTGGGGCCCTGGGAAGAGGAAGG + Intergenic
1067459718 10:46448828-46448850 TTGGGGCCCAGGAAGGATACGGG + Intergenic
1067561313 10:47306768-47306790 TGGGGAACCATGAAGGTGGAAGG + Intronic
1067627469 10:47935785-47935807 TTGGGGCCCAGGAAGGATACGGG - Intergenic
1067922378 10:50472911-50472933 GTGGGGAGCAGGATAGAGGAAGG - Intronic
1069895828 10:71679511-71679533 TCGGGGCCCAGCCAGGAGGAGGG + Intronic
1069939031 10:71940812-71940834 TTGGGGAAGAGGAAGGAGAGAGG + Intergenic
1070342920 10:75514181-75514203 TTGGGAACCAAGAAGAAGAAAGG - Intronic
1070410150 10:76132239-76132261 TTGGAGCCCAAGAAGCAGGAAGG + Intronic
1070493124 10:76995911-76995933 TTGGGAAACAAGAAGGAGAAAGG - Intronic
1070494825 10:77011915-77011937 TTGGGGAATAGGAATGAGAAAGG + Intronic
1071312083 10:84352476-84352498 TTGGGGAGTAGGAAGAATGACGG + Intronic
1071937776 10:90549934-90549956 TTGGGGACGAGGTATGTGGACGG + Intergenic
1072039878 10:91596841-91596863 TTGGGGAGGAGGATGGAAGAGGG + Intergenic
1072108022 10:92291830-92291852 TTGGGGAGGGGGAAGGGGGAGGG - Intronic
1073297506 10:102450124-102450146 GTGGGGAGGAGGAAGGAGGGAGG + Exonic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1074162656 10:110846893-110846915 ATGTGGAGCTGGAAGGAGGAAGG - Intergenic
1074184019 10:111085854-111085876 TTGGGGAACAGGCTGGAGGGAGG + Intergenic
1074600642 10:114909901-114909923 TTGGGGGACAGGGAGCAGGATGG + Intergenic
1075057448 10:119230098-119230120 TGGGGGAGCAGGGAGCAGGAAGG + Intronic
1075645218 10:124092470-124092492 GCGGGGAGGAGGAAGGAGGAGGG + Intronic
1075796398 10:125123062-125123084 TTAGAGACCAGGAAGTAGGTAGG + Intronic
1076625272 10:131818004-131818026 AAGGGGAGCAGGAAGAAGGAAGG + Intergenic
1076725332 10:132410454-132410476 TGCGGGAGCAGGAAGGAGGGTGG + Intronic
1076779471 10:132716221-132716243 ATGGGGTTCAGGATGGAGGACGG - Intronic
1076894044 10:133300714-133300736 TTTGGGACGAGGCAGGTGGATGG - Intronic
1077078105 11:710279-710301 TTGGCCACCAGGAAGGATGTGGG - Intronic
1077188111 11:1244501-1244523 GTGGTGCCCAGGGAGGAGGAGGG - Exonic
1077189066 11:1248272-1248294 GTGGTGCCCAGGGAGGAGGAGGG - Exonic
1077189629 11:1250456-1250478 GTGGTGCCCAGGGAGGAGGAGGG - Exonic
1077205115 11:1338305-1338327 TGGGGGACCAGAAAGGATGGAGG - Intergenic
1077289573 11:1782655-1782677 TTGGGTAGCAGGAAGGGGCAGGG - Intergenic
1077672522 11:4168648-4168670 ATGGGGGCCAGGAAGGAGAAGGG - Intergenic
1077700141 11:4433683-4433705 TGTAGGAGCAGGAAGGAGGAGGG + Intergenic
1078525504 11:12097964-12097986 TTGGGGCCGAGGCAGGAGGATGG - Intronic
1079081457 11:17416088-17416110 TTGGGGACAAGGAGGGAGAAAGG + Intronic
1079130363 11:17743726-17743748 ATGAGGACCAGGGAGGAGGCTGG - Intronic
1079378644 11:19917261-19917283 TTGGAAACCAGCAAGGAGGTGGG - Intronic
1080076690 11:28158148-28158170 TTGGGGAACAGGTATGTGGATGG + Intronic
1080701555 11:34648899-34648921 TAGGTGACCAGGCAGTAGGATGG + Intronic
1080723830 11:34875094-34875116 ATGGGGAGCTGGAAAGAGGATGG - Intronic
1080877461 11:36289611-36289633 AGGGGGACCAGGGCGGAGGATGG + Intergenic
1080913134 11:36625942-36625964 CTGAGGACCAGCAAGGAGGCCGG + Intronic
1081620996 11:44619141-44619163 TTGGGGGCCAGGCAGGGAGATGG - Exonic
1081866802 11:46364753-46364775 TTGGGCAGGAGGAAGGATGAAGG - Intronic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1083306524 11:61764736-61764758 TTGGGCATCATGAGGGAGGACGG - Intronic
1083402157 11:62431040-62431062 CAGGGGACCAGGAAGAGGGAAGG - Intergenic
1083424984 11:62578858-62578880 TGGGGCGCCAGGGAGGAGGAAGG + Exonic
1083464168 11:62834234-62834256 TTGGGGGAAAGGAAGGAGCAGGG - Intronic
1083630370 11:64092099-64092121 TTGGAGGCCAGGAAGGACGGTGG - Intronic
1083843476 11:65317372-65317394 GGCGGGAGCAGGAAGGAGGAAGG - Intronic
1084009134 11:66338062-66338084 TTGAGGAGCAGGAACCAGGATGG - Intronic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1085188560 11:74597698-74597720 TGGAGGACAAGGCAGGAGGATGG - Intronic
1085348605 11:75783965-75783987 GTGGGGCCCAGAAAGGAGTAAGG - Intronic
1085998342 11:81949762-81949784 TTGGGGACTCGGAAGGGGAAGGG - Intergenic
1089009928 11:115123918-115123940 TTGGGTCCCACTAAGGAGGAGGG + Intergenic
1089220828 11:116870058-116870080 CAGGGGACAAGGAAGAAGGAGGG + Intronic
1089380659 11:118028873-118028895 TTGGGGGAGAAGAAGGAGGAGGG + Intergenic
1089887688 11:121844109-121844131 TTGGCCAGCAGGAAGGAGGAAGG + Intergenic
1089926529 11:122264057-122264079 TTGGGTAACAGGGAGGAGGAAGG - Intergenic
1090407968 11:126488759-126488781 GTGGGGAACAGGTAGGAGCAGGG - Intronic
1091058196 11:132438561-132438583 GTGGGCAGCAGGAAGGTGGAAGG + Intronic
1091089145 11:132753177-132753199 CTGGGAGCCAGGAAGGAGTATGG - Intronic
1091269138 11:134293362-134293384 TTTGGGATGGGGAAGGAGGAGGG + Intronic
1091448381 12:557858-557880 TTGGAGACTAGGAATCAGGAAGG - Intronic
1091838823 12:3604826-3604848 CTGTGGCCCAGGCAGGAGGAGGG - Intergenic
1093531957 12:20176079-20176101 TTGGGGAGGAAGAAGGATGAAGG - Intergenic
1093707572 12:22291303-22291325 TTGGTCACCAGGCAGGAAGAAGG + Intronic
1093759374 12:22890286-22890308 TTGGGGACTATGAAAGAGTAGGG + Intergenic
1093865102 12:24216680-24216702 TGGGAGACCAAGAAGGAGGGCGG + Intergenic
1093881239 12:24406471-24406493 TTGGGGCACAGGAAAGAAGAGGG - Intergenic
1095965254 12:47863182-47863204 ATGGGGACCAGGAGGCAGGTAGG + Intronic
1096261506 12:50095268-50095290 TTTGGGAACATGAAGGAGAAAGG + Intronic
1096436653 12:51596647-51596669 TTTGGAAGCAGGAAGGATGAGGG + Intronic
1096469889 12:51869327-51869349 TGGGGGAAGAGGAGGGAGGAGGG + Intergenic
1096636091 12:52960562-52960584 TTGGGGATCAGCAGCGAGGATGG + Intergenic
1096838194 12:54364668-54364690 TTGGGTTTCAGGAAGGAGAAAGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098101413 12:67021288-67021310 TTGGGGGACAGGAAGAAGGAGGG - Intergenic
1098314879 12:69182519-69182541 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1098475896 12:70902721-70902743 TTGGGGACCAGGGAGAAGAGTGG + Intronic
1098547969 12:71731965-71731987 TGGGGGAGCAAGAAGGGGGATGG - Intergenic
1098744093 12:74213579-74213601 ACGGGGAGCAGGAAGGGGGATGG + Intergenic
1100260610 12:92929163-92929185 GAGGGGACCGGGAAGGAGGTCGG + Exonic
1100387012 12:94112949-94112971 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1100402581 12:94245246-94245268 TTTGGGAACAGCAAGTAGGAGGG - Intronic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1100817007 12:98396394-98396416 GTAGGAAGCAGGAAGGAGGATGG - Intergenic
1101658989 12:106749344-106749366 TGGGGGACATGGGAGGAGGAGGG + Intronic
1101708526 12:107243314-107243336 TTGAGGACAAGGAGGCAGGAAGG + Intergenic
1102200646 12:111055622-111055644 TTGGGGGCCAGGCGGGAGGCAGG - Intronic
1102239301 12:111314027-111314049 CCGGGGACCAGGCAGGAGGGAGG - Intronic
1102451495 12:113045058-113045080 GGGGGGAAAAGGAAGGAGGAGGG + Intergenic
1102568441 12:113812458-113812480 TTGGGGACCAGGAGAAGGGAGGG + Intergenic
1102839530 12:116103355-116103377 GTGGGGCCAAGGCAGGAGGATGG - Intronic
1102930794 12:116860601-116860623 TTGGGGTCTAGGAGGGAGGATGG - Exonic
1103033861 12:117640687-117640709 CGGGGGCCCAGGGAGGAGGAAGG - Intronic
1103058891 12:117842982-117843004 TTGGGAAGGAGGGAGGAGGAAGG + Intronic
1103059784 12:117849100-117849122 TTGAGGACTAAGAAGGAGAAAGG + Intronic
1103072622 12:117957437-117957459 ATGGTGGCCAGGAAGGAGGATGG - Intronic
1103080426 12:118019609-118019631 CTGAGGATCAGGAAGGAAGAAGG - Intronic
1103179038 12:118891709-118891731 CTGAAGACTAGGAAGGAGGATGG + Intergenic
1103200159 12:119081654-119081676 CTGGGGAACAGGATGCAGGAAGG + Intronic
1103883821 12:124186312-124186334 TTGGGGAGGAGGTAGAAGGAGGG + Intronic
1103952916 12:124561383-124561405 TTGGGGAACAGAAACCAGGAGGG + Intronic
1104057755 12:125243712-125243734 TTGGGGACTATGACGGAAGAGGG - Intronic
1104096813 12:125565602-125565624 GTGGGGAGCTGGAAGGGGGATGG + Intronic
1104340245 12:127942726-127942748 TTGGGGACCTTGAAACAGGAGGG + Intergenic
1104645281 12:130493030-130493052 CTGGGGCTCAGGCAGGAGGATGG + Intronic
1104842735 12:131832380-131832402 TGGGGGAACGGGAAGGGGGAAGG + Intronic
1106713535 13:32364335-32364357 CTTGGGACCATGAATGAGGATGG - Intronic
1107115211 13:36739619-36739641 AATGGGACCAGGAAGAAGGAAGG + Intergenic
1108254640 13:48598550-48598572 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1109448937 13:62483423-62483445 TTGGGGACTAAAAAGAAGGATGG - Intergenic
1110189351 13:72713617-72713639 TTGGGGAACAGGGGGAAGGATGG - Intronic
1110433900 13:75458209-75458231 ATGGGGAGCTGGAAAGAGGATGG + Intronic
1111073408 13:83200055-83200077 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
1112674148 13:101678862-101678884 TTGGGGAGGAGAAAGGAGTAGGG - Intronic
1112832196 13:103466876-103466898 TGAGGGACATGGAAGGAGGAAGG + Intergenic
1113416929 13:110136096-110136118 CTGGGGACCAGGCAGGGGCAAGG + Intergenic
1113536886 13:111075206-111075228 GTGAGGACAAGGCAGGAGGATGG - Intergenic
1114423230 14:22602049-22602071 TGGGGGAGAAGGAAGGAGGAAGG - Intronic
1116389383 14:44374926-44374948 TTGGTCAACAGGAAGCAGGAAGG - Intergenic
1116858672 14:49976229-49976251 TGGAGGAGCAGGAAGGTGGAAGG + Intergenic
1117558622 14:56912077-56912099 GTTAGGAACAGGAAGGAGGAAGG - Intergenic
1117617282 14:57546432-57546454 GGGGGGACCAGAAGGGAGGAGGG + Intergenic
1117871457 14:60205209-60205231 CTGGGGATCAGGAAGGGAGAGGG + Intergenic
1118215856 14:63808014-63808036 TTGGGGACTAGGAGGAAGGGTGG - Intergenic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1118738929 14:68724182-68724204 TTGACAACCAGGAGGGAGGATGG - Intronic
1118907630 14:70034016-70034038 TTGGGGACCAGGAGTAAGGATGG - Intergenic
1119331801 14:73800478-73800500 TTTAGGACCAGGGAGGAGGAGGG + Intergenic
1119667896 14:76498126-76498148 TTGGGGTCCAGGAGGCAGCATGG - Intronic
1119928611 14:78521842-78521864 TTGGGAACCAAGAAAAAGGAAGG + Intronic
1120994393 14:90405645-90405667 ATGGGGACAAGGCAGGTGGAGGG + Exonic
1121009084 14:90509445-90509467 CTGGGGTCCAGGAGGGAGAAAGG - Intergenic
1121236085 14:92392094-92392116 TAGGGCCCCGGGAAGGAGGAAGG - Intronic
1121322392 14:92999576-92999598 CTGAGGCCCAGCAAGGAGGAGGG - Intronic
1121449114 14:93996535-93996557 GTGGGGGCCAGGAATGAGGGAGG - Intergenic
1121508567 14:94494914-94494936 CTGGGAACCAGGGAGGTGGAAGG - Intronic
1121625600 14:95383605-95383627 TTGGGGACAAGGAAGCAGCCTGG - Intergenic
1121666519 14:95676626-95676648 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1121797612 14:96748013-96748035 TTGGGGACCAGCAAGTTGGCAGG + Intergenic
1121957318 14:98226351-98226373 TTGGGGGCCATGAAGGATGGTGG - Intergenic
1122006043 14:98704677-98704699 GTGGGGAGCAGGAAGGAAGGGGG - Intergenic
1122117604 14:99535590-99535612 GTCGGGCCCAGGAGGGAGGAGGG + Intronic
1123069048 14:105632247-105632269 TGGGCCCCCAGGAAGGAGGATGG + Intergenic
1123073207 14:105652234-105652256 TGGGCCCCCAGGAAGGAGGATGG + Intergenic
1123093132 14:105751005-105751027 TGGGCCCCCAGGAAGGAGGATGG + Intergenic
1123143741 14:106108363-106108385 TTGGAGAACAGCCAGGAGGAGGG + Intergenic
1123191841 14:106579133-106579155 TTGGAGAACAGCCAGGAGGAGGG + Intergenic
1123468428 15:20532869-20532891 TTGGGTCCCAGGAAGGAGATGGG + Exonic
1123649687 15:22468194-22468216 TTGGGTCCCAGGAAGGAGATGGG - Exonic
1123728745 15:23128079-23128101 TTGGGTCCCAGGAAGGAGATGGG + Intergenic
1123740089 15:23277014-23277036 TTGGGTCCCAGGAAGGAGATGGG - Intergenic
1123746909 15:23325544-23325566 TTGGGTCCCAGGAAGGAGATGGG + Intergenic
1123761755 15:23438848-23438870 TTGGGTCCCAGGAAGGAGATGGG + Intergenic
1124391910 15:29267007-29267029 AAGGGGACCAGGAGGCAGGAAGG + Intronic
1124532415 15:30519203-30519225 TTGGGTCCCAGGAAGGAGATGGG - Intergenic
1124613273 15:31223655-31223677 TTGGGCCCAAGGCAGGAGGAAGG - Intergenic
1124766238 15:32488442-32488464 TTGGGTCCCAGGAAGGAGATGGG + Intergenic
1125126431 15:36227595-36227617 TGGGAGACCAGGCAGGAGGAAGG + Intergenic
1125529847 15:40406005-40406027 TTGGGGACCAGGCAGGAAGGAGG - Intronic
1125529856 15:40406030-40406052 ATGGGGACCAGGCAGGAAGGAGG - Intronic
1125535814 15:40440904-40440926 CTGGGGACGAGGAAGCAGGAAGG + Intronic
1126322929 15:47444986-47445008 ATGGGGAGCTGGAAGGGGGATGG + Intronic
1126725610 15:51628606-51628628 TAGGGAAACAGGATGGAGGAAGG - Intergenic
1127323666 15:57872707-57872729 TTGGGGAGCAGAAAGTAGGCAGG - Intergenic
1127488108 15:59437955-59437977 GTGGGAACGAGGAGGGAGGAGGG + Intronic
1127543200 15:59963779-59963801 TGGGGGACGAGGTGGGAGGATGG + Intergenic
1127722579 15:61717372-61717394 GCGGGGAGCAGGGAGGAGGAGGG + Intergenic
1127854340 15:62942413-62942435 TTGGAGGTTAGGAAGGAGGATGG - Intergenic
1128241962 15:66107394-66107416 TTAGTGGCCAGGAGGGAGGAAGG + Intronic
1128587827 15:68866472-68866494 TTGGGGTCCTGGGAAGAGGAAGG - Intronic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1129113014 15:73349129-73349151 CTGGAGACCAGGAAGGAGGTGGG - Intronic
1129450990 15:75651357-75651379 TTGGGGAGGTGGCAGGAGGAAGG - Intronic
1129653411 15:77507294-77507316 GTGGGGAGCAGGGAAGAGGAAGG - Intergenic
1129664597 15:77572463-77572485 TTGGGGAGCAGGAGGTATGAGGG + Intergenic
1130138141 15:81198655-81198677 CTGGGAACCAGAAAGGGGGAGGG - Intronic
1130559209 15:84945398-84945420 TGGGGGAGCAGGAAGGGGGATGG - Exonic
1130560418 15:84953889-84953911 ATGGGCACCAGGAGGGATGAGGG + Intergenic
1131072032 15:89471970-89471992 TAGGGTGCCAGGAAAGAGGAAGG - Intronic
1131207964 15:90467513-90467535 TGGAGACCCAGGAAGGAGGATGG + Exonic
1131341939 15:91610724-91610746 ATGGGAACCAGGGAAGAGGATGG + Intergenic
1131456935 15:92588918-92588940 GTTGGGACCAGGCAGGAAGAGGG - Intergenic
1131747874 15:95469221-95469243 GTGGGGATGAGGAAGGAGCACGG + Intergenic
1131781710 15:95866724-95866746 CTGTGGACCAAGCAGGAGGAAGG + Intergenic
1132568516 16:634148-634170 TGGGGCACCTGGAAGGATGAGGG - Intergenic
1132572379 16:649666-649688 TCGGGGACCAGGCAGGAGCCGGG - Intronic
1133149667 16:3818179-3818201 TGGGGGGCCGGGGAGGAGGACGG + Intronic
1133520260 16:6549463-6549485 GTGGGGAGGAGGGAGGAGGAGGG + Intronic
1133598315 16:7314104-7314126 TTGGGGAGGAGGAAGGGAGAGGG + Intronic
1133981699 16:10637436-10637458 GAGGGGAGGAGGAAGGAGGAGGG + Intronic
1134182934 16:12062058-12062080 TTGGGGATCAGGAAGTAGCTTGG + Intronic
1134347975 16:13409216-13409238 ATGGGGAACTGGAAGGGGGATGG - Intergenic
1134586196 16:15413532-15413554 TTGTGGACAAAGAAAGAGGAAGG - Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135485838 16:22863845-22863867 TTGGGAACCACAAAGGATGAAGG - Intronic
1135629521 16:24024919-24024941 TCAGGTAGCAGGAAGGAGGAGGG + Intronic
1136093259 16:27935748-27935770 CTGAGGACCAGGGAGCAGGAGGG - Intronic
1136240045 16:28937985-28938007 TTGGGGGTCAGGATGGGGGATGG - Intronic
1136413835 16:30091798-30091820 ATGGGGACCAGGGAGGACTACGG - Intronic
1136710691 16:32234376-32234398 TAGGGGCCCAGGAAAGAGAAAGG - Intergenic
1137001435 16:35233788-35233810 TGGGGGCCTAGGAAAGAGGACGG + Intergenic
1137017730 16:35393683-35393705 CAGGGGCCCAGGAAGGAGAAAGG + Intergenic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137238563 16:46635324-46635346 GTTGGGAACAGGAAGGAGGAAGG + Intergenic
1137511996 16:49108899-49108921 GTGGGGAGGAGGAAGGATGATGG - Intergenic
1138345929 16:56320211-56320233 TTGGGCACACGGGAGGAGGATGG - Intronic
1138439878 16:57027717-57027739 TTGGGAACAAGGAAAGAGCATGG + Intronic
1138592834 16:58011750-58011772 GTGGGCTCCAGGAAGGAAGATGG - Intronic
1139132454 16:64162773-64162795 ATTGGGATCAGGAAGGAGAAAGG - Intergenic
1139328051 16:66167103-66167125 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1139333157 16:66209980-66210002 TTCAGGACCAGGAAGCAGCATGG - Intergenic
1139401437 16:66684919-66684941 CAGGGCTCCAGGAAGGAGGAAGG - Intronic
1140890226 16:79278794-79278816 TTGGGGGCCAGCAGGCAGGAAGG - Intergenic
1141213803 16:82005460-82005482 TTGGGGATCAGGAAGGGAGGAGG - Intronic
1141458241 16:84159126-84159148 CTTAGGACCAGGGAGGAGGAAGG - Intronic
1142203811 16:88773345-88773367 GTGGGGGCCAGGGAGGAGGTGGG + Intronic
1142329833 16:89444702-89444724 TTGGAAAACAGGAAGGAGGATGG + Intronic
1142666679 17:1467579-1467601 TGGGGGGCCAGGCAGGAGGAGGG + Intronic
1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG + Intronic
1145004821 17:19331966-19331988 TTGGGGCCCAGGAAGGACTCAGG - Exonic
1145056452 17:19706804-19706826 GTGGGGAGCAGGAATGAGGTGGG - Intronic
1145242902 17:21250037-21250059 GTGGGGACCAGGACAGAGCAGGG - Intronic
1146169488 17:30621700-30621722 TTGGGGAGCGGGAAGAAGGCCGG + Intergenic
1146170074 17:30625749-30625771 TTGGGGAGCGGGAAGAAGGCCGG - Intergenic
1146343526 17:32041778-32041800 TTGGGGAGCAGGGAGGAGGCCGG - Intronic
1146678754 17:34792053-34792075 TTGGGGCCATGAAAGGAGGATGG + Intergenic
1146935657 17:36811176-36811198 GTGGGGAGCAGGAGGGAGGGAGG - Intergenic
1146955816 17:36935935-36935957 TTGGGAAGAGGGAAGGAGGAGGG - Intergenic
1147215694 17:38897807-38897829 TTGGTGCCCAGAAAGGAGGGTGG - Intronic
1147944222 17:44071198-44071220 GTGGGGACCAGGATGCCGGAGGG - Intronic
1148537768 17:48455162-48455184 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1148648070 17:49230545-49230567 TTGGGGCGCAGGATGGAGCAAGG + Exonic
1148831055 17:50431731-50431753 TTGAGGCCAAGGCAGGAGGATGG - Intronic
1148845424 17:50527179-50527201 CAGGGGACCAGGAACCAGGAGGG - Intronic
1149558303 17:57589897-57589919 TTGGGGACCAGGTAGGACGATGG + Intronic
1149888390 17:60363855-60363877 TTTGGGAGAAGGAAGGAGGAAGG + Intronic
1150106189 17:62464356-62464378 TGGGAGGCCAGGAAGGTGGAGGG + Intronic
1150448555 17:65246477-65246499 TTGGGGTCCAGGAAGGGAGGAGG + Intergenic
1150585479 17:66513832-66513854 TAGGGGAACAGGAAGTAGAAGGG + Intronic
1150633596 17:66897606-66897628 TTGCAGAGAAGGAAGGAGGAAGG - Intergenic
1150635637 17:66911387-66911409 TTGGGATCCAGGAAACAGGAGGG - Intergenic
1150782410 17:68134230-68134252 TTGGGGAGCGGGGAGGAGGCCGG + Intergenic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1150962765 17:69932905-69932927 TTGGAGACCATGAAGGAGACAGG + Intergenic
1151711307 17:75808586-75808608 CTGGGATGCAGGAAGGAGGAAGG - Intronic
1151886706 17:76926923-76926945 TTGGGGAGCAGGAAGCATGGAGG + Intronic
1152038473 17:77888096-77888118 TGGGGGAGCAGGAGGGAGGGAGG - Intergenic
1152070075 17:78129973-78129995 CTGGAAACCAGGAAGGAGGTGGG + Intronic
1152100809 17:78300883-78300905 TGGGGGAACAGGAAGGTGGAGGG - Intergenic
1152111483 17:78359738-78359760 TTCGGGACCAGGTAGGAAGGAGG - Exonic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152444980 17:80337234-80337256 TTGGGGACCTGGCAGAATGATGG + Intronic
1152782425 17:82232176-82232198 TTGTGGCCCAGGCAGGAGGCGGG - Intronic
1152921898 17:83070028-83070050 GTGGGGACCCGGAAGGATCAGGG - Intergenic
1152931088 17:83110199-83110221 TGGGGGAGGAGGAAGGAGGCCGG + Intergenic
1153312285 18:3688836-3688858 CTGGAGACCAGAAAGGAGGCCGG - Intronic
1153530340 18:6039645-6039667 TTAGGGCCCAGGAAACAGGATGG - Intronic
1153950982 18:10057487-10057509 TAGGGGACAGGGAAGGAGAATGG + Intergenic
1155683705 18:28520914-28520936 ATGGGGAGCTGGAAAGAGGATGG - Intergenic
1156048133 18:32900237-32900259 ATGGAGACAAGGAAGTAGGAGGG + Intergenic
1156929669 18:42626457-42626479 TTGAGAACCAGGAAAGAGAAAGG - Intergenic
1157444731 18:47736221-47736243 TTGGGACACAGGAAGGACGAGGG + Intergenic
1157475223 18:48019732-48019754 CTGGGGACCAGCAGAGAGGAGGG - Intergenic
1157614695 18:48979508-48979530 CTGGGCACCTGGAGGGAGGAAGG + Intergenic
1158375299 18:56856797-56856819 TAGGGGAGGAGGCAGGAGGACGG - Intronic
1158776688 18:60590919-60590941 TTAGGGACTAGGCATGAGGAAGG + Intergenic
1159096265 18:63906008-63906030 TGGGGGACTAGGAAAGAGAAAGG - Intronic
1159505564 18:69330807-69330829 TTGGGGACTAGGAGAGAGAAAGG - Intergenic
1160387539 18:78505619-78505641 TTGGGGGCCAGGAGGGAGGAAGG - Intergenic
1160550898 18:79693202-79693224 GTGGTGACCGGGAGGGAGGATGG + Intronic
1160583014 18:79898428-79898450 GTGGGGACTGGGCAGGAGGAGGG + Intronic
1160806670 19:995040-995062 CTCAGGACCAGGCAGGAGGAGGG + Intronic
1160853330 19:1205367-1205389 TTGCGGACCTGGAAGGAGCGGGG - Intronic
1160941407 19:1621972-1621994 TGGGGGGTCAGGCAGGAGGAGGG + Intronic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1161496902 19:4591445-4591467 CTGGAGGCCAGGAAGGAGGAGGG + Intergenic
1161709177 19:5838301-5838323 TCCGGGGCCAGGAAGGATGAAGG + Intronic
1162028697 19:7908309-7908331 TGGAGGACCAGGCAGGAGCAGGG - Intronic
1162389377 19:10380226-10380248 GTGGGGACGAGAAAGGAGGAAGG - Intronic
1162789012 19:13053590-13053612 TTGGGAATGAGGATGGAGGATGG - Intronic
1162907274 19:13831361-13831383 TTGGGCTCCAGGAGGGAGGCTGG + Exonic
1163030598 19:14541626-14541648 TTTGGGGCCAGGGAGGAGAATGG + Intronic
1163221211 19:15922518-15922540 TTGGGTTTCTGGAAGGAGGATGG - Intronic
1163283022 19:16328552-16328574 TTGGGGAGGAGGAAGGATGCAGG - Intergenic
1163430165 19:17262693-17262715 TTGGGAAGCAGGAAGGGGCAGGG - Exonic
1163582681 19:18147677-18147699 GTGGGCCCCAGGAGGGAGGAAGG + Intronic
1163779753 19:19240065-19240087 ATGAGGAGCAGGAGGGAGGAGGG - Intronic
1164632600 19:29771504-29771526 ATGGGGTCCAGGTAGGAGGCAGG - Intergenic
1164731051 19:30504577-30504599 TTGGAGAGAGGGAAGGAGGAAGG - Intronic
1165001180 19:32763789-32763811 TATGGGACCAGGAGTGAGGAGGG - Intronic
1165116718 19:33533258-33533280 CTGGAAACCAGGAAGGAGGAGGG - Intergenic
1165705768 19:37975275-37975297 CCGGGGACCAGGAAGGAGGATGG + Intronic
1165776922 19:38410089-38410111 CAGGGGACCTGGAAGGAGGAAGG + Exonic
1165797401 19:38526932-38526954 TTGTGGGTCAGGAAGGAGGATGG + Intronic
1165853868 19:38868711-38868733 TTTAGGAGCAGCAAGGAGGAGGG + Intronic
1165895710 19:39139689-39139711 TTGGGGAGTGGGCAGGAGGATGG - Intronic
1165900581 19:39167554-39167576 CTGGGGCCCAGGATGGAGGGCGG - Intronic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166254673 19:41594670-41594692 TTAGGGAGCAGGAAGGAGCAAGG + Intronic
1166279900 19:41784963-41784985 GTAGGGAACAGGAAGGAGCAGGG + Intergenic
1166412853 19:42568241-42568263 GTAGGGAACAGGAAGGAGCAGGG - Intergenic
1167476586 19:49704984-49705006 CTGGGGACCAGGAGAGGGGATGG - Intronic
1167477515 19:49709468-49709490 TTGGGGATGGGGATGGAGGAGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167703835 19:51066496-51066518 GTGGGGGAGAGGAAGGAGGAAGG + Intergenic
1168114105 19:54211382-54211404 TAGGGGGCCAGGAGGGAGGTTGG + Intronic
1168140497 19:54383543-54383565 TTGTGGAGCTGGAAGGAGAAAGG + Intergenic
1168277978 19:55287518-55287540 CTGGGGACACGGTAGGAGGATGG - Intronic
1168429734 19:56268786-56268808 TCGGGGACTAGGAATGGGGAGGG - Intronic
1168644031 19:58048441-58048463 TTGGAGACCAGGCTGGACGATGG + Intronic
925058389 2:872519-872541 ATGGGGTCCGGGGAGGAGGATGG - Intergenic
925488003 2:4357764-4357786 ATGGGGAGCAGGAAAGAGCAAGG - Intergenic
925691123 2:6524544-6524566 CTGGGGACCAGGTTGGAGGCTGG + Intergenic
925836520 2:7951996-7952018 ATGGGCAACAGGAAGGAGGCTGG - Intergenic
925941137 2:8820197-8820219 TAGGGGATCAGTAAGGAGGTGGG - Intronic
925947641 2:8880411-8880433 TGCGGGAGGAGGAAGGAGGAGGG + Intronic
926453363 2:13034985-13035007 TTGTGGAGTAGGAAGGAAGATGG + Intergenic
926805919 2:16710879-16710901 TTGGGGACTAAGAAGAAGAATGG + Intergenic
927335765 2:21922443-21922465 TTTGATAACAGGAAGGAGGAGGG - Intergenic
927692299 2:25216543-25216565 TGGAGGACGAGGAGGGAGGATGG + Intergenic
928305582 2:30167769-30167791 TGGTGGACTAGGAAGGAAGATGG - Intergenic
928308565 2:30191423-30191445 TTGATGACCAGAAAGGAGGAAGG - Intergenic
928393480 2:30926847-30926869 TTGGGGGCCAGGAGAAAGGAGGG + Intronic
929714062 2:44292960-44292982 TTTGGGGCCAGGGAGGAGGATGG + Intronic
929906411 2:46050076-46050098 CTGGGGACCAGGCAGCAGGGCGG - Intronic
929945900 2:46371641-46371663 TCAGGGACCAGGAAGCATGAAGG - Intronic
931405639 2:61974932-61974954 CAGGGGTTCAGGAAGGAGGAGGG - Intronic
931926052 2:67073734-67073756 TTGGGCAGGTGGAAGGAGGAAGG - Intergenic
932405647 2:71511223-71511245 CTGGGGGGCAGGAAGGAAGAGGG + Intronic
932544046 2:72688453-72688475 TTGCCCACCAGGAAGGAGGATGG - Intronic
932598872 2:73110973-73110995 TTGGGCTCCAGGAACCAGGAAGG + Intronic
932702425 2:74000998-74001020 TTGGGGACCAGGATAAAGGAGGG + Intronic
932841659 2:75088740-75088762 TCGGTGACAAGGAAGGGGGATGG + Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933789647 2:85873463-85873485 GTGGGGACAAGGGAGGAGGGAGG + Intronic
933871921 2:86574954-86574976 TTGGGGTGTGGGAAGGAGGATGG - Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934523534 2:95034615-95034637 CTGGGGGCCAGGATGGAGGCTGG - Intronic
934577904 2:95414564-95414586 TTCTGGAGCAGGGAGGAGGAAGG - Exonic
934601535 2:95662138-95662160 TTCTGGAGCAGGGAGGAGGAAGG + Intergenic
934606599 2:95699830-95699852 CTGGGAACCAGGAGGGAGGGAGG + Intergenic
934652527 2:96100585-96100607 TCAGGGTCCAGGAAGAAGGAAGG + Intergenic
934734884 2:96685136-96685158 TTGGGAAGCAGGAAGGATGTGGG + Intergenic
934982541 2:98856283-98856305 TTGGAGACCAGAAAGCAGTAGGG + Intronic
935033862 2:99348771-99348793 TTGGGGATGGGGACGGAGGAAGG + Intronic
935122565 2:100195835-100195857 TAGGGGAGTTGGAAGGAGGAGGG + Intergenic
935383581 2:102478583-102478605 TAGGAAAGCAGGAAGGAGGATGG + Intronic
935669904 2:105546302-105546324 TTGGGGAGCAGGAAGGATTGGGG - Intergenic
936012806 2:108936020-108936042 GTGGTGACCAGTAGGGAGGACGG - Intronic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936534895 2:113304302-113304324 TTCTGGAGCAGGGAGGAGGAAGG + Intergenic
936540003 2:113341958-113341980 CTGGGAACCAGGAGGGAGGGAGG + Intergenic
937858279 2:126688574-126688596 TTGGGAACCAGGAACCAGGCAGG - Intronic
937910713 2:127074262-127074284 GTGGGGACCAGGAAGGAATGGGG - Intronic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
938606142 2:132894786-132894808 TTGGGGAGCAGGGCGGAGGGCGG - Intronic
939044980 2:137239424-137239446 TTGGGGACAGGGAAGGAGGACGG - Intronic
941079269 2:161041221-161041243 CTTGAAACCAGGAAGGAGGAGGG + Intergenic
941164247 2:162068457-162068479 TTGGGAACCATGATGGAGGCTGG - Intronic
941225117 2:162838766-162838788 GTGGGGAACGGGAAGGAGGCGGG + Intergenic
941846918 2:170142488-170142510 TTGGAGACCGGGAAGGAGGCAGG - Intergenic
942301268 2:174564756-174564778 TTGGTGCCCAAGAAGGAAGAAGG + Intronic
942670549 2:178370887-178370909 ATGGGGACCAGGATGGAGAGAGG + Intronic
942725658 2:179004833-179004855 GTGGGGCCGAGGCAGGAGGATGG - Intronic
943563647 2:189492297-189492319 TTGGGGACCATGTTGGAGGCTGG - Intergenic
943862947 2:192892146-192892168 TTGGGGAGCAGGAAGGTGTGGGG + Intergenic
944341182 2:198602266-198602288 CTAGAGACCAGGAAGGATGATGG + Intergenic
944794013 2:203163573-203163595 TTTGGGAGGATGAAGGAGGAAGG - Intronic
944874216 2:203945152-203945174 TTTGGGAGCAGCATGGAGGAGGG + Intronic
945472486 2:210242800-210242822 TTAGGGATGAGCAAGGAGGAGGG - Intergenic
946193246 2:218018690-218018712 CTGGGGAACAGGAAGGAGTCTGG + Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946243471 2:218371358-218371380 TGGGGCTCCAGGGAGGAGGAAGG + Intergenic
946412280 2:219521406-219521428 TGGGGGTCCAGGAAGGAGTGCGG - Intronic
946445940 2:219740045-219740067 CTGGGGGCCAGGGAGGAGGCAGG + Intergenic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
947587052 2:231362858-231362880 TTTGGGGTCAGGCAGGAGGAAGG - Intronic
947590228 2:231381167-231381189 ATGGGGTTCAGGATGGAGGATGG - Intergenic
947733739 2:232444469-232444491 CTCTGGCCCAGGAAGGAGGAGGG - Intergenic
948036570 2:234862879-234862901 TGGGGGACCAGGGAAGGGGAGGG + Intergenic
948537700 2:238658441-238658463 TTGGGGCCCAGGAACGAGGAGGG + Intergenic
1168876099 20:1173341-1173363 TTGGGGATCAGGGAGGAGGAGGG - Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169142229 20:3233166-3233188 GTGTGGCCCAGGAAGGAGCAGGG + Intronic
1169431825 20:5543058-5543080 TTTGGTAGAAGGAAGGAGGAAGG + Intergenic
1169503556 20:6184584-6184606 TGGGGAGCCAGAAAGGAGGATGG + Intergenic
1170834059 20:19868691-19868713 TTGGGGACCCAGAAAGGGGAAGG + Intergenic
1171010779 20:21508436-21508458 TTGGGGAGGAGGCTGGAGGAGGG - Intergenic
1171264008 20:23755602-23755624 TTGAGGACCAGGGCAGAGGAAGG - Intergenic
1172204961 20:33156805-33156827 CTGGGCACCAGGCAGGAGGCAGG + Intergenic
1172480953 20:35271112-35271134 TTGGGGACCTGGGAGGCAGAAGG + Intronic
1172588991 20:36104549-36104571 GTGGGGACCAGGGAGGTGGGGGG + Intronic
1172780484 20:37433919-37433941 CTGGGGACCAGGAGGTAGGGTGG - Intergenic
1173176968 20:40771856-40771878 TGGGGGTCCTGGAGGGAGGAGGG - Intergenic
1173186735 20:40846081-40846103 TTGGGGACCATCTTGGAGGATGG + Intergenic
1173300052 20:41794474-41794496 TTGGGGAGAAGGAAGGAGGGAGG - Intergenic
1173336440 20:42115849-42115871 TTGGGGGTCTGGAAGGAGAAAGG + Intronic
1174208835 20:48861016-48861038 CTGGGCCCCAGGAAGGAGGCAGG - Intergenic
1175211084 20:57355771-57355793 TAGGAGAACAGGAGGGAGGATGG + Intronic
1175303749 20:57961474-57961496 TTGGAGATCAGCAGGGAGGAGGG - Intergenic
1175374711 20:58516050-58516072 AAGAGAACCAGGAAGGAGGAGGG + Intergenic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1176031638 20:63015748-63015770 TTGAGCAGCAGGAAGGAAGATGG - Intergenic
1176051272 20:63120845-63120867 TTGGGGAGGAGGATGGAGAATGG - Intergenic
1176123876 20:63466489-63466511 GTGGAGGCCAGGAGGGAGGATGG - Intronic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178094292 21:29197488-29197510 ATGGGGAGCTGGGAGGAGGATGG - Intronic
1178213738 21:30569208-30569230 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1178279652 21:31270507-31270529 TTAGGGACTAGGTAGGAGGGAGG + Intronic
1178394706 21:32232730-32232752 GTGGTTACCAGGAAGGTGGAAGG + Intergenic
1178720871 21:35007879-35007901 TTGGGTACCAGGGAGGATCAGGG - Intronic
1178969678 21:37161613-37161635 GTGGGGAGCAGAAAGGGGGATGG + Intronic
1179025125 21:37673432-37673454 TGGAGCCCCAGGAAGGAGGATGG - Intronic
1179031125 21:37720490-37720512 CAGGGGACCTTGAAGGAGGAGGG + Intronic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179085025 21:38208230-38208252 CTGGAGCCCAGGAAGCAGGAAGG - Intronic
1181084417 22:20432674-20432696 TCAGGGACCAGGGTGGAGGAAGG + Intronic
1181442736 22:22945032-22945054 CAGGTGACCAGGAAGGAGGAGGG + Intergenic
1181774476 22:25149561-25149583 TTGGGGAGGGGCAAGGAGGAAGG - Intronic
1182074239 22:27484036-27484058 AGGGGGTCCAGGAAGGAGCAGGG - Intergenic
1182082450 22:27538899-27538921 ATGTGGACAGGGAAGGAGGAAGG - Intergenic
1182129951 22:27843633-27843655 TTGGTGCCCAGGAGGGAGGCTGG + Intergenic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182429913 22:30293378-30293400 TGGGGTACCAGGGAGGAAGACGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182692058 22:32171102-32171124 TTGGGGGATAGGGAGGAGGATGG + Intergenic
1183034860 22:35133921-35133943 ATGGAGACAAGGGAGGAGGAAGG + Intergenic
1183188151 22:36304301-36304323 ATAGGGAACAGGAAGAAGGAGGG - Intronic
1183272668 22:36871822-36871844 CTGGGCACCAGGAGGAAGGAAGG + Intronic
1183345411 22:37304667-37304689 TTTGGGACCAGGCAAGAGGTGGG - Intronic
1184106740 22:42371752-42371774 ATGAGGACCAGGCAGGAAGAGGG - Intergenic
1184156163 22:42668812-42668834 TTGGGGACCAGAGAGTAGAAAGG - Intergenic
1184226261 22:43130322-43130344 TTGGAGGCCAGGATGGAGGGAGG - Intergenic
1184355867 22:43979272-43979294 TCTGGGCCCAGGAAGGAGGCAGG - Intronic
1184387863 22:44186521-44186543 TGAGGGAATAGGAAGGAGGATGG - Intronic
1184408191 22:44312057-44312079 CTGGGGACCAGGGAGGCTGAGGG - Intronic
1184430689 22:44440167-44440189 CTGGGGACCAGGCAAGAGGCTGG + Intergenic
1185243955 22:49763410-49763432 TGGGGGAAGAGGAAGGAGGAGGG + Intergenic
949169950 3:985970-985992 TTGGGGACGAGGTATGTGGATGG - Intergenic
949437982 3:4049896-4049918 ATGGGGAGCTGGAAGGGGGATGG + Intronic
949638992 3:6014145-6014167 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
950488243 3:13285418-13285440 TTGGGAGCCAGGAAGGAGGGTGG - Intergenic
950667216 3:14504976-14504998 GTGGGTACCAGGAGGGAGGGAGG + Intronic
951670891 3:25180754-25180776 TAGGGGAGAAGGAAAGAGGAAGG + Intronic
953507091 3:43496859-43496881 TGAGGAACCAGGAAGGAGAAAGG - Intronic
954035382 3:47848414-47848436 CTGGGGACCAGGCAGGTGGGAGG + Intronic
954105696 3:48408806-48408828 TGGGGGATGAGGAAGAAGGAGGG - Intronic
954413638 3:50382240-50382262 TGGGGGTCCCTGAAGGAGGAAGG - Intronic
954422159 3:50424518-50424540 TAGGGGACCTGGGAGGAGGGAGG - Intronic
954425068 3:50438848-50438870 GTGGGGAAAAGCAAGGAGGAAGG + Intronic
954504214 3:51053008-51053030 TTGGGGTGGAGGATGGAGGAAGG + Intronic
954661435 3:52228949-52228971 CTGGAGCCCAGGAAGGAGGATGG + Exonic
954848845 3:53583299-53583321 GTAGGGACCAGGCAGGAAGACGG - Intronic
955322732 3:57985874-57985896 GTGGAGACCAGGATGGAGCAGGG + Intergenic
955476125 3:59338068-59338090 TTGAGGCCCAGCAAAGAGGATGG + Intergenic
956541436 3:70344417-70344439 ATGGGGAACTGGAAGGGGGATGG - Intergenic
956767321 3:72494574-72494596 TTGGGGACCATCACGGAGGCTGG + Intergenic
957412650 3:79860997-79861019 TTCAGAACCAGGAAAGAGGATGG - Intergenic
958017933 3:87964451-87964473 TTGTGGCTCAGGGAGGAGGAGGG - Intergenic
958833545 3:99117654-99117676 TTGGGCAATAGGAAGGAAGAAGG + Intergenic
959206503 3:103313856-103313878 TTGGGGACTATGAAGGTGAACGG + Intergenic
960365530 3:116767009-116767031 GTGAGGCCCAGGAAGCAGGAGGG - Intronic
961311909 3:126007681-126007703 TTGGGGAGAAGGAAGGAGCTGGG - Intronic
961383459 3:126510577-126510599 CTGGGGGCCAGGAACAAGGAGGG - Intronic
961805296 3:129485004-129485026 GTGGGGACCAGGCAGGAGGGAGG - Intronic
961910257 3:130307595-130307617 TTGGGGATCAGGGAGAAGAATGG + Intergenic
962051881 3:131824842-131824864 TTGGGGAGCAGGAAGCAAAATGG + Intronic
962375699 3:134857132-134857154 TTGGGGGGCAGGGAGGTGGAGGG + Intronic
963331726 3:143922744-143922766 TTGGGGAACAGGTATGTGGATGG - Intergenic
963718127 3:148827923-148827945 TTGGGGGCTAGCAAGGAAGAAGG - Intronic
964145773 3:153461206-153461228 TTTGGGTGCAGGAAGGAGGCTGG - Intergenic
964304718 3:155327583-155327605 CAGGGGACCAGGGAGCAGGAGGG - Intergenic
964814277 3:160700494-160700516 TTGGGGGGAAGGAAGAAGGATGG + Intergenic
965863004 3:173169780-173169802 TTGGAGACCAAGAAAGAGCATGG + Intergenic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
966876524 3:184325253-184325275 TTCGGGGCTAGGAAGGAGAAAGG - Exonic
966917052 3:184590852-184590874 TGCGGGAGCAGGAAGCAGGAGGG - Intronic
967341334 3:188401755-188401777 TTGGGGAACAGGAAAGCAGATGG + Intronic
967468068 3:189830791-189830813 TTTGGGACTTTGAAGGAGGAAGG + Intronic
967820439 3:193834604-193834626 TTGGGTCCCAGGAAGGAGTGTGG - Intergenic
968313149 3:197700746-197700768 TAGGGGACCAGGAAGGAGGTGGG - Exonic
968463521 4:737811-737833 GTGGGGCCCAGGAAGAAGGCAGG - Intronic
968477790 4:820574-820596 TTTGGTGCCGGGAAGGAGGAAGG + Intronic
968602397 4:1516424-1516446 TGGGGCACCAGCAAGGAGGGAGG + Intergenic
968729830 4:2264468-2264490 TGGGGGAGCAGGAAGGAGTTGGG + Intergenic
969150817 4:5167180-5167202 TTGGGGGCAAGGTGGGAGGATGG - Intronic
969470729 4:7385976-7385998 TTGGAGGCCAGAAAGGAGGGAGG + Intronic
969542416 4:7801251-7801273 TTGAGGAGCAGGAAGGCGGCAGG - Intronic
970046641 4:11861847-11861869 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
971558282 4:28040838-28040860 TTGGGGATGTGGGAGGAGGATGG + Intergenic
972543507 4:40058923-40058945 TAGGGGACGAGGTGGGAGGATGG - Intronic
973721110 4:53724532-53724554 GTGGGGAGGAGGAAGGAGGGAGG - Intronic
975740884 4:77427749-77427771 TTGGTGTCTAGGGAGGAGGAAGG + Intronic
975892703 4:79048670-79048692 TTGGGAACTAGGAAGAAGGAAGG + Intergenic
976178441 4:82377031-82377053 TTGGGAGACAGGAAGGAGAATGG - Intergenic
977285730 4:95104455-95104477 GTGGGCACCAAGAAAGAGGATGG + Exonic
977306295 4:95327773-95327795 AAGGGGAGCTGGAAGGAGGATGG - Intronic
977330251 4:95628597-95628619 TGGGGGACCAGGAAAGATGAGGG + Intergenic
978482009 4:109203465-109203487 ATGGGACCCAGGAAGGAGGAAGG + Intronic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
979671528 4:123364677-123364699 TGTGGGAGCAGGAAGAAGGACGG + Intergenic
980107757 4:128604074-128604096 TAGGAGACCAGGCAGGAGGATGG + Intergenic
980585584 4:134810605-134810627 TTGGGGAGCCTGAAGCAGGAGGG - Intergenic
980871459 4:138615753-138615775 ATGGGGACCTGGAAAGGGGATGG - Intergenic
981616389 4:146648362-146648384 TTGTGGACGAGGAAGGAAGGTGG + Intergenic
981669437 4:147270465-147270487 TTGGGGACTAAGAGGGAAGAGGG - Intergenic
981815859 4:148829867-148829889 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
982448368 4:155521953-155521975 TCGGGGACTAAGAGGGAGGATGG - Intergenic
982591954 4:157324671-157324693 TTTGGGACCAGTGAGGAGGGAGG + Intronic
982959447 4:161818273-161818295 TGGGGGAGCCGGAAGGAAGATGG - Intronic
983117798 4:163841107-163841129 ATGGGGACCAGGGAGGAGGCAGG + Intronic
983267975 4:165527702-165527724 TTGTGGACTAGGAAGAAGTAGGG + Intergenic
984129543 4:175856694-175856716 ATGGGGACCTGGAAAGGGGATGG + Intronic
984613980 4:181874719-181874741 TAGGGCACCAGAAAGGAGGATGG - Intergenic
985155680 4:186984882-186984904 TTAGGAGCCAGGGAGGAGGAGGG - Intergenic
985293181 4:188407019-188407041 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
985828922 5:2213534-2213556 TTTGGGACCAGGAAGGGGAGGGG + Intergenic
986230964 5:5864561-5864583 ATGGGGAGCTGGAAGGTGGAGGG + Intergenic
986241587 5:5964912-5964934 TTGAGCACCAGGGAGGTGGAAGG - Intergenic
986773546 5:10994448-10994470 GCGGGGGCCGGGAAGGAGGAAGG + Intronic
986808305 5:11329669-11329691 TTGGAGACCAGGAGAGAAGAAGG + Intronic
986854612 5:11854098-11854120 TTTGGGAACAACAAGGAGGACGG - Intronic
986952959 5:13113381-13113403 AAGGGGGCCTGGAAGGAGGAAGG + Intergenic
987038623 5:14041265-14041287 CTGGGGACCATGAGGCAGGAAGG - Intergenic
987046119 5:14110479-14110501 TTTGGGATGAGGTAGGAGGATGG + Intergenic
987251755 5:16107906-16107928 ATGGGGAGCTGGAAGGGGGATGG - Intronic
987369347 5:17179184-17179206 TTGGGGTCCAGGATGTAGGCAGG + Intronic
988355324 5:30166408-30166430 TTGGGGACCAGGAGAAAGGGTGG - Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988925903 5:35991011-35991033 TTGCGGACCTGGCTGGAGGAGGG - Intronic
988934226 5:36066560-36066582 TTGCGGACCCGGCTGGAGGAGGG - Intronic
989310939 5:40017311-40017333 TTTGGTACCAGGAAGTAGGATGG + Intergenic
989719123 5:44504014-44504036 TTGGGGAGCTGGAAGGGGGATGG - Intergenic
990041816 5:51386035-51386057 TCGGGGTACAGGAAGGGGGAGGG + Intronic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990476018 5:56162405-56162427 TGGGGGAACTGGCAGGAGGAGGG + Intronic
991557668 5:67913946-67913968 TAAGAGAACAGGAAGGAGGAAGG + Intergenic
991644996 5:68792664-68792686 TTGGGGATCTGGAAAGGGGATGG + Intergenic
992226086 5:74620787-74620809 ATGGGGAGCTGGAAAGAGGATGG + Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993475364 5:88357754-88357776 AGGGGGTACAGGAAGGAGGATGG + Intergenic
993754495 5:91711065-91711087 TTGGGGGCCTGGGAGGAGGAAGG + Intergenic
994310275 5:98261313-98261335 ATGAGGATCAGGAATGAGGAGGG + Intergenic
995494484 5:112726336-112726358 ATGGGGAGCTGGAAGGGGGATGG + Intronic
995792900 5:115911779-115911801 TGGGGGAGCAGGAAGGAAGGGGG + Intronic
997228686 5:132227941-132227963 CTGGGGACCAGGACGCAGGCAGG - Intronic
997338629 5:133125184-133125206 TTGGGCAACAGGAATGATGAGGG + Intergenic
997766003 5:136503989-136504011 ATGGGGATGAGGCAGGAGGAAGG - Intergenic
998416185 5:141947835-141947857 TTGGGGGTAAGGAAAGAGGAGGG - Intronic
998562127 5:143181444-143181466 TTAGGGAGCATGGAGGAGGAAGG - Intronic
998821012 5:146057836-146057858 TTGGGGCTGAGGCAGGAGGATGG + Intronic
998868521 5:146529853-146529875 ATGGGGAACTGGAAGGGGGATGG - Intergenic
999196154 5:149782925-149782947 GTAGGGAGCAGGAAGGAAGAAGG + Intronic
999291187 5:150427603-150427625 TCAGGGACCAAGAAGGAGAATGG - Intergenic
1000121007 5:158197865-158197887 TTGGATACCAGGAAGGAGGCTGG + Intergenic
1000608506 5:163350100-163350122 ATTGGGGCCAGGAAGGAGAAAGG - Intergenic
1001251837 5:170152761-170152783 TAGGAGGCCAGGAAGAAGGAAGG - Intergenic
1001302737 5:170548611-170548633 TTTGGTACTAGGAAGGTGGATGG - Intronic
1001310063 5:170604102-170604124 GTGGGAACCAGGGAAGAGGAGGG + Intronic
1001523544 5:172412886-172412908 TTGGGGAGTAGGAAGGGAGAAGG + Intronic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001595851 5:172898325-172898347 TTGAGGCCCAGGGAGGTGGAGGG + Intronic
1002070860 5:176678328-176678350 TTGGGGAGCAGGAAGATAGATGG - Intergenic
1002109138 5:176896272-176896294 AAGGGGACCAGGAAGGAAGCTGG + Intronic
1002527780 5:179824428-179824450 TAGGGCACCAGGAAGGTGGGGGG - Intronic
1002633213 5:180594434-180594456 TTGGGGATCAGGCAGGCCGAGGG + Intergenic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1003053017 6:2796923-2796945 TTGAAGGGCAGGAAGGAGGAGGG + Intergenic
1003442414 6:6155437-6155459 GTGGGGAGCAGGGAGAAGGATGG + Intronic
1004160226 6:13206143-13206165 GTGGGCACCAGGAGGGAGGACGG + Intronic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004178925 6:13364630-13364652 GTGGGGATCAGGGAGGTGGAGGG - Exonic
1004204029 6:13574777-13574799 CTGGAGACCAGGGAGGGGGATGG + Intronic
1004321933 6:14638735-14638757 GTGGGGAGCAGAAAAGAGGAAGG - Intergenic
1005284977 6:24315659-24315681 TTTGGGAGCAGAAAGGAGGCTGG + Intronic
1005492971 6:26363719-26363741 TTGGGGAGGGGGAAGGGGGAGGG + Intergenic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1006084802 6:31587973-31587995 CTGGGGACAGGGAAGGGGGAGGG + Intronic
1006174267 6:32112481-32112503 GTGGGGAGAAGGGAGGAGGAAGG + Intronic
1006178190 6:32136402-32136424 TTTGGGACCAAAAAGGAGGGAGG - Intergenic
1006276580 6:33009187-33009209 TTGGGTCTCAGGAAGGAGGAAGG + Intronic
1006373672 6:33659976-33659998 TCTGGGACCAGGAAGGAGACAGG - Intronic
1006384164 6:33719891-33719913 TTGGTGAGAAGGAAGGAGGGAGG + Intergenic
1006594333 6:35182062-35182084 TTGGGGCCCAGCAAGGAGCCTGG - Intergenic
1006778671 6:36616929-36616951 CTGAGGCCCAGGGAGGAGGAGGG + Intergenic
1007764665 6:44153550-44153572 CTGGGGCCCGGGCAGGAGGAGGG + Intronic
1009404090 6:63291414-63291436 TTGGGGAGCAGGAAATGGGATGG + Intronic
1009438843 6:63651704-63651726 TTGGGGAAGGGGAAGGAGCAGGG - Intronic
1009632353 6:66214916-66214938 TTGTGCACCAGGAAGGAGCCTGG + Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010117595 6:72333003-72333025 GAGGGGACAAGGAAGGAGGAGGG + Intronic
1010325245 6:74555969-74555991 TTGGGGAACAGGTATGCGGATGG - Intergenic
1010465311 6:76161243-76161265 ATGGGAACCAAGAAGAAGGATGG - Intergenic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1012042978 6:94234048-94234070 ATGGGGAGCAGGAAGGGGGATGG - Intergenic
1013406754 6:109850430-109850452 TTGGGGAACAGGTATGTGGATGG + Intergenic
1015118518 6:129675891-129675913 TTGCGGACAAGAATGGAGGAGGG - Intronic
1015253120 6:131148007-131148029 ATTGGGACCAGAAAGAAGGAAGG + Intronic
1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG + Intronic
1015681933 6:135818120-135818142 TTGGGGAACAGGAAAAAGAAAGG + Intergenic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1016532797 6:145076540-145076562 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1016576177 6:145571959-145571981 TTGGGGAATAGGTAGGTGGATGG - Intronic
1016757121 6:147698950-147698972 TTGGGCAACAGAAAGGAGGCTGG + Intronic
1018158626 6:161014901-161014923 TTGGGGACCGGGCAGGGGGTTGG - Intronic
1018218933 6:161559578-161559600 TAGGGAGCCAGGAAGGAGGATGG - Intronic
1018303264 6:162426553-162426575 TTGGGGATGAGGTGGGAGGATGG - Intronic
1018534941 6:164809870-164809892 TTGGGGAACAGGTAGGTGGATGG - Intergenic
1018541844 6:164889267-164889289 TTGGCCAGCAGGAAGGAGCAGGG - Intergenic
1018617013 6:165696103-165696125 TTGGGGAGGGGGAAGGAAGATGG + Intronic
1018813288 6:167313186-167313208 TTGGGGACCCAGAAGGTGGCTGG - Intronic
1018816797 6:167338939-167338961 AGGGAGAGCAGGAAGGAGGAAGG - Intronic
1019148500 6:169988857-169988879 TGGGGGAGCAGGACGGAGGCTGG - Intergenic
1019268416 7:132034-132056 TGAGGGACCAGGGAGGAGGGTGG + Intergenic
1019367429 7:642009-642031 TTGGGGAGGAGGGAGGAGGGCGG - Intronic
1019420604 7:949017-949039 TTGGGGACAAGGAGGGCCGAGGG - Intronic
1019578576 7:1749233-1749255 TGGGGGACAAGGAGGGAGGGAGG + Intergenic
1020061000 7:5152201-5152223 GTGGAGACCTGGAAGCAGGATGG - Intergenic
1020648088 7:10840659-10840681 TTGGGGTCCAGGAGGGAAGTTGG + Intergenic
1021196464 7:17679713-17679735 TTGGGGCGCAGGAGGGAGGAGGG + Intergenic
1021510139 7:21426180-21426202 TTGGTGAACTGGGAGGAGGAGGG + Intergenic
1022901072 7:34811256-34811278 ATGGGGAACTGGAAGGGGGATGG + Intronic
1023216521 7:37868739-37868761 TAGGGCACCGGGAAGGTGGAAGG - Intronic
1023412266 7:39899963-39899985 TTAGGCACCAAGAAGGGGGAAGG + Intergenic
1023767694 7:43527214-43527236 TTCTGGACAAGCAAGGAGGAGGG + Intronic
1023888848 7:44378523-44378545 TGGAGGACCAGGAGGGTGGAAGG + Intergenic
1024061471 7:45702061-45702083 TTGAGGGCCAGGTACGAGGATGG - Intronic
1024283967 7:47741300-47741322 TTGGGGTCAAGGCAGGAGGCAGG - Intronic
1024338561 7:48234469-48234491 GTGGGGTCCAGGTAGGAAGATGG + Intronic
1025205877 7:56993131-56993153 CTTGGGACCAGGGAGGAGGCAGG + Intergenic
1025666063 7:63583807-63583829 CTTGGGACCAGGGAGGAGGCAGG - Intergenic
1025724384 7:64043940-64043962 TTGGAGGCCAGCTAGGAGGAGGG - Intronic
1026557782 7:71422892-71422914 ATGGGGAGCAGGAAGGGGGATGG + Intronic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1026832449 7:73618530-73618552 TTGGAGACCAGGGAGGAGAGAGG - Intronic
1026867201 7:73831160-73831182 TTGAGGACCTGGAAGGCTGAGGG - Exonic
1027706143 7:81535912-81535934 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1028002581 7:85518706-85518728 TCGGGGAGAAGGAAGGAGGGAGG + Intergenic
1028564386 7:92212199-92212221 TTGGGGAGCAGGATGAAGTATGG - Intronic
1028984237 7:96997381-96997403 ATGGGGAGCAGGAGGGAGGGGGG + Intergenic
1029293817 7:99523250-99523272 CTGGGGTACAGGAAGGAGGAAGG + Intronic
1029637363 7:101793944-101793966 CTGGGGAGCAGGGAGGAGGGAGG + Intergenic
1029712884 7:102309126-102309148 CTGGGGACCTGGAAGGAAGTTGG + Intronic
1029869841 7:103679127-103679149 TTTGGGACCAGGGGGGAGGGCGG + Intronic
1029910215 7:104137765-104137787 TTGGGGAGCCCGAAGGAGGATGG - Intronic
1030548109 7:110923979-110924001 TAAGGGCCAAGGAAGGAGGAAGG - Intronic
1030610751 7:111686464-111686486 TTGGGGGCCAGGTAGCAGGTGGG + Intergenic
1031526575 7:122828633-122828655 TAGAGAACCAGGAAGAAGGAAGG - Intronic
1031693444 7:124818730-124818752 GTGGGGAACTGGAAGGGGGATGG - Intergenic
1031970337 7:128060538-128060560 TTAAGGAGCAGGGAGGAGGAAGG - Intronic
1032035255 7:128516944-128516966 TGGGAGGCCAGGAAGGTGGAGGG + Intergenic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032095236 7:128935001-128935023 GTGGGGAGCAGGGGGGAGGAGGG - Intergenic
1032186590 7:129732017-129732039 CTGGGGACCAGCAGAGAGGAAGG - Intronic
1032246219 7:130215595-130215617 TTGGGGAGCAGGAACTAAGAAGG - Intronic
1032326806 7:130936517-130936539 TTGTGGTCCAGGAGGGAGGTGGG - Intergenic
1033090692 7:138383065-138383087 TTTGGCAAAAGGAAGGAGGAAGG - Intergenic
1034270968 7:149803292-149803314 TTGGGATCCAGGCAGGAGGGTGG - Intergenic
1034276683 7:149826841-149826863 GTGGGGAGCAGGGATGAGGAAGG + Intergenic
1034333368 7:150303255-150303277 CTGTGTTCCAGGAAGGAGGAGGG - Intronic
1034391528 7:150791404-150791426 GTGGGGAGAAGAAAGGAGGAGGG + Exonic
1034414079 7:150955829-150955851 GTGGGGACCTGGTAGAAGGAGGG - Intronic
1034664675 7:152806632-152806654 CTGTGTTCCAGGAAGGAGGAGGG + Intronic
1035339591 7:158151682-158151704 TTGGGGAGAAGGAAGAAAGAAGG - Intronic
1035548226 8:499999-500021 TTGAGGACCAAGAAGAATGATGG + Intronic
1037292176 8:17362655-17362677 TTAGGGGCCTGGAACGAGGAAGG - Intronic
1037442905 8:18935434-18935456 GTGGGGCCGAGGCAGGAGGATGG + Intronic
1037796275 8:21997843-21997865 GTGGGGGGGAGGAAGGAGGAAGG + Intronic
1038411088 8:27360503-27360525 GGAGGGACCTGGAAGGAGGAAGG - Intronic
1039026556 8:33264665-33264687 TTTGGGGCAAGGCAGGAGGATGG + Intergenic
1039180913 8:34864959-34864981 TTGGAGACCTTGAAGGATGAAGG - Intergenic
1039364633 8:36917000-36917022 GTGGAGACCAGGAAGGAAAAGGG - Intronic
1039475736 8:37838594-37838616 GGGGTGACCAGGAAGGAGAAGGG - Intronic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1039902370 8:41762203-41762225 TCAGGGCCCAGGGAGGAGGAAGG - Intronic
1040602361 8:48897362-48897384 ATGGGGAGCAAGAAGGGGGATGG + Intergenic
1041012753 8:53559990-53560012 TTGGGGAGCAGGAGGGTTGAGGG - Intergenic
1042155122 8:65836896-65836918 AGGGGGAGGAGGAAGGAGGATGG - Intronic
1042621759 8:70714073-70714095 GTGGGGATGAGTAAGGAGGAGGG + Intronic
1042984371 8:74566688-74566710 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1043220454 8:77655814-77655836 TTGGGGAGCTGGAAAGGGGATGG - Intergenic
1043392147 8:79802189-79802211 TTGGTGTCCAGCAGGGAGGAAGG - Intergenic
1043656449 8:82674032-82674054 TTGGGGACCAGGAATTAGTCTGG - Intergenic
1043999786 8:86865442-86865464 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1044026999 8:87184663-87184685 CTGGGGGCCAGGAAGGAGTCTGG + Intronic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044820721 8:96154147-96154169 TTGGGGAGAAGGACAGAGGACGG - Intronic
1045098779 8:98825484-98825506 TCGGGGAGCGGGAAGAAGGAGGG - Intronic
1045133253 8:99182317-99182339 TTTGGGAGGATGAAGGAGGAAGG + Intronic
1045322015 8:101089296-101089318 ATTGGGAGAAGGAAGGAGGATGG + Intergenic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1046742667 8:117845692-117845714 TTGGGGACTGGGAAGGATGTGGG - Intronic
1047113788 8:121818524-121818546 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1047521816 8:125600758-125600780 TTGGGGAGCAGAAGGGAGGAGGG + Intergenic
1049479968 8:142817942-142817964 CGGTGGACCAGGCAGGAGGAGGG + Intergenic
1049752532 8:144291903-144291925 GTGGGGACCGGGAGGGAGCAGGG + Intronic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050090855 9:2015896-2015918 TGGGGGACAGGGGAGGAGGATGG + Intronic
1050874346 9:10615412-10615434 GTGGGGAGGAGGTAGGAGGAAGG - Intergenic
1051263471 9:15288534-15288556 ATGGGGAGCTGGAAGGGGGATGG - Intronic
1051983800 9:23057633-23057655 ATGAGGAGCAGGAAAGAGGATGG - Intergenic
1052522432 9:29564856-29564878 ATGAGGACCAGTAAGGAGGAAGG + Intergenic
1052917232 9:33932754-33932776 GTGGGGATAAGGAATGAGGATGG - Intronic
1052999765 9:34571499-34571521 GTGTGGACCAGGAAGGAGCTGGG - Intronic
1053391947 9:37742213-37742235 TTGGGGAGCAGTAAGGAGTCTGG - Intronic
1053437303 9:38084554-38084576 ATGGGGATTAGGAAGGAGGAAGG + Intergenic
1054910792 9:70453475-70453497 TTGGGAACCAGAAAGCAGGCTGG + Intergenic
1056037049 9:82617912-82617934 TTGGCGTCAAGGAAGGAGGAAGG + Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056685221 9:88753596-88753618 TTGGGGTCCAGGTAGAAAGATGG + Intergenic
1056769576 9:89467145-89467167 GTGGCCACCAGGAAGGAGGCAGG - Intronic
1057017514 9:91665691-91665713 TTGGGGACAAGGAAAGAAGGAGG - Intronic
1057311383 9:93945366-93945388 TTGGAGCCCAGGACGGAAGAAGG + Intergenic
1057825911 9:98371931-98371953 CTGGGCAGCAGGAAGAAGGAAGG - Intronic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058754365 9:108070658-108070680 CTGTGGACCAGGGAGAAGGATGG + Intergenic
1058766581 9:108188006-108188028 TGGGGGCCCAGGTAGCAGGAAGG - Intergenic
1058954164 9:109930186-109930208 TTGGGGAGAAGGAATGAGAAAGG - Intronic
1059111170 9:111559558-111559580 CTGGTGAGCAGGAAGAAGGAGGG - Intronic
1059444078 9:114327524-114327546 GTGGGGACCAGGCTGGAGGCAGG + Intergenic
1059445285 9:114334303-114334325 GTGGGGACCAGGCTGGAGGCAGG + Exonic
1059615518 9:115946712-115946734 CAGGTGACCAGGAAGGGGGAGGG + Intergenic
1060198154 9:121636427-121636449 TTCAGGAGCAGGAGGGAGGAGGG + Intronic
1060389443 9:123267010-123267032 TTGGGGAGGAGGAAGGTGGAGGG - Intronic
1060650982 9:125326806-125326828 TTGGGCAGCTGGGAGGAGGATGG - Intronic
1060888998 9:127176406-127176428 TGGGGGACGAGGAGGGAGCAGGG + Intronic
1060943504 9:127556834-127556856 TGGGAGGCCAGGCAGGAGGATGG + Intronic
1061100461 9:128488040-128488062 CTGGGGACCAGGCAGCTGGATGG + Intronic
1061246152 9:129402132-129402154 TTGGGGAGCAGGGAGGAGGTGGG - Intergenic
1061281144 9:129598101-129598123 TTAGGGACCGGGAAACAGGACGG - Intergenic
1062097958 9:134712417-134712439 AGGGGGAACAGGAAGGAGTAGGG - Intronic
1062097981 9:134712495-134712517 AAGGGGGACAGGAAGGAGGAGGG - Intronic
1062284613 9:135767558-135767580 TTGGGGTGCAGGAGGGAGGGGGG - Intronic
1062702245 9:137913395-137913417 CAGGGAACCAGGCAGGAGGAAGG + Intronic
1203584153 Un_KI270746v1:47638-47660 TTGGGGACAAGGACGGATGGCGG + Intergenic
1185567736 X:1108603-1108625 TTGGGGCCCAGGGAGGGGGAAGG + Intergenic
1185577561 X:1185897-1185919 TTGGGGGGCAGGATGGAGGGGGG + Intergenic
1185827033 X:3261343-3261365 CTGCAGACCAGGAAGGAGGAAGG + Intergenic
1185928173 X:4170647-4170669 CTGGGGAGGAGGAAGGATGAAGG + Intergenic
1186218659 X:7326320-7326342 TTAGTGACCAGGAATGTGGACGG + Intronic
1186750035 X:12612271-12612293 TTGAGGGCCAGGAAGGAGAGAGG - Intronic
1186925475 X:14329042-14329064 TTGAGGACTAGGAAGTGGGAGGG - Intergenic
1187067260 X:15853949-15853971 TTGGTGACCAGAAAGGGTGAGGG + Intronic
1187467368 X:19539461-19539483 TTAGGGATTAGGAAGGAAGAAGG + Intronic
1187483631 X:19681567-19681589 TTTAGTACCAGGAAGGGGGATGG + Intronic
1187706138 X:22011364-22011386 TTGGAGGCCAGGAAGGGTGACGG + Intergenic
1187841833 X:23496815-23496837 TTGGGGGCTAGGAAGGAGGGAGG - Intergenic
1188269379 X:28119966-28119988 TCTGGGATCATGAAGGAGGAAGG + Intergenic
1188680261 X:32995005-32995027 TGGGGGTTCAGGTAGGAGGATGG + Intronic
1188811217 X:34656602-34656624 TTGGCGACCAGGGATGGGGAGGG + Intronic
1189242005 X:39532565-39532587 TGGGGGAGAAGGGAGGAGGAAGG + Intergenic
1189935363 X:46062506-46062528 CTGGGGAGCAGGAATGGGGAAGG - Intergenic
1190398575 X:50009442-50009464 TTGGGGCCTAGCAAGGAGGTTGG - Intronic
1190630571 X:52381481-52381503 TGGGGAACCAGGAAGGGGCAGGG + Intergenic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192156943 X:68753692-68753714 CTGGGGGCCTGCAAGGAGGAGGG + Intergenic
1192318200 X:70067740-70067762 AAGGGGACCTGGAAGGAGAAGGG + Intergenic
1194119463 X:89942998-89943020 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1194763076 X:97816994-97817016 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1195004222 X:100670677-100670699 ATGGGGACCAGGGATGAGGTGGG + Intronic
1195355898 X:104039928-104039950 TTGGGGACCAGGGAAGTGGGGGG - Exonic
1195696219 X:107669582-107669604 TGGGGGAGGAGGAAGGAGGAAGG - Intergenic
1195934630 X:110113051-110113073 TGGCGGAAAAGGAAGGAGGAAGG - Intronic
1196442371 X:115728489-115728511 TGGGGGACCAGGCAGGACTAGGG - Intergenic
1196443186 X:115732415-115732437 TGGGGGACCAGGCAGGACTAGGG + Intergenic
1196443845 X:115735383-115735405 TGGGGGACCAGGCAGGACTAGGG + Intergenic
1196444329 X:115737514-115737536 TGGGGGACCAGGCAGGACTAGGG - Intergenic
1196445507 X:115844330-115844352 TGGGGGACCAGGCAGGACTAGGG + Intergenic
1196446178 X:115847311-115847333 TGGGGGACCAGGCAGGACTAGGG + Intergenic
1196446849 X:115850292-115850314 TGGGGGACCAGGCAGGACTAGGG + Intergenic
1196447517 X:115853275-115853297 TGGGGGACCAGGCAGGACTAGGG + Intergenic
1196448188 X:115856254-115856276 TGGGGGACCAGGCAGGACTAGGG + Intergenic
1196448857 X:115859245-115859267 TGGGGGACCAGGCAGGACTAGGG + Intergenic
1196449528 X:115862236-115862258 TGGGGGACCAGGCAGGACTAGGG + Intergenic
1196450197 X:115865219-115865241 TGGGGGACCAGGCAGGACTAGGG + Intergenic
1196450867 X:115868204-115868226 TGGGGGACCAGGCAGGACTAGGG + Intergenic
1196451538 X:115871183-115871205 TGGGGGACCAGGCAGGACTAGGG + Intergenic
1196452209 X:115874170-115874192 TGGGGGACCAGGCAGGACTAGGG + Intergenic
1196452879 X:115877139-115877161 TGGGGGACCAGGCAGGACTAGGG + Intergenic
1196453549 X:115880132-115880154 TGGGGGACCAGGCAGGACTAGGG + Intergenic
1196454218 X:115883141-115883163 TGGGGGACCAGGCAGGACTAGGG + Intergenic
1196455298 X:115888212-115888234 TGGGGGACCAGGCAGGACTAGGG + Intergenic
1196457119 X:115898613-115898635 TAGGGGACCAGGCAGGACTAGGG - Intergenic
1196464412 X:115958218-115958240 TAGGGGACCAGGCAGGACTAGGG - Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1198143764 X:133833400-133833422 TCAGTGACAAGGAAGGAGGAGGG + Intronic
1198486250 X:137090349-137090371 TTGGGAACCAGGAAGTTAGAGGG + Intergenic
1198518202 X:137428799-137428821 TTCGGGACCCAGAACGAGGAAGG + Intergenic
1198961337 X:142186429-142186451 TTGGGCACCAGGTTGAAGGAGGG + Intergenic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic
1199769970 X:150969094-150969116 CTGGGGACCTGGAGGGAGGTGGG - Intergenic
1199803390 X:151273230-151273252 TAAGGGACCAGGAGGGAAGATGG + Intergenic
1199825742 X:151497922-151497944 TTGGGGAAGAGGATGGGGGAGGG - Intergenic
1199895915 X:152127753-152127775 TTGGGGAAGAGAATGGAGGAGGG - Intergenic
1199951364 X:152708678-152708700 TTGGGGAAGAGGATGGAGGAGGG + Intergenic
1199954011 X:152727902-152727924 TTGGGGAAGAGGATGGAGGAGGG + Intronic
1199955681 X:152740551-152740573 TTGGGGAAGAGGATGGAGAAGGG - Intergenic
1199958319 X:152759783-152759805 TTGGGGAAGAGGATGGAGGAGGG - Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200472336 Y:3600555-3600577 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1201300732 Y:12502559-12502581 TTGGGGAGCTGGAAAGGGGATGG - Intergenic