ID: 1015503459

View in Genome Browser
Species Human (GRCh38)
Location 6:133956965-133956987
Sequence TCTTTTCTTTAGAAGACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 736
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 688}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015503457_1015503459 23 Left 1015503457 6:133956919-133956941 CCAGGCTACATAGACAAATTTGA 0: 1
1: 0
2: 0
3: 8
4: 178
Right 1015503459 6:133956965-133956987 TCTTTTCTTTAGAAGACAGATGG 0: 1
1: 0
2: 2
3: 45
4: 688

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015503459 Original CRISPR TCTTTTCTTTAGAAGACAGA TGG Intronic
900016457 1:153706-153728 TCTTTTCTTTTTAAGAGACAGGG - Intergenic
900046717 1:512298-512320 TCTTTTCTTTTTAAGAGACAGGG - Intergenic
900068922 1:754015-754037 TCTTTTCTTTTTAAGAGACAGGG - Intergenic
900216224 1:1483115-1483137 TCTTTTTTTTAGTAGAGACAGGG - Intronic
900704546 1:4072076-4072098 TCCCTACTTTAGAACACAGATGG + Intergenic
902072889 1:13756075-13756097 TTTTTTTTTTAGAAGAGACAGGG - Intronic
902950164 1:19876189-19876211 TTTTTTCTTTAAAAGAGACAAGG - Intergenic
903092643 1:20935818-20935840 GGTTTTCTTTAAAAGACTGAGGG + Intronic
904022883 1:27481387-27481409 TCTTATTTTGAGAATACAGAAGG - Intronic
904691500 1:32296526-32296548 TTTTTTGTTTAGAAGACAAACGG + Intronic
905248544 1:36631185-36631207 ACTGATCTTGAGAAGACAGAAGG - Intergenic
905556153 1:38886124-38886146 TATTTTCTTTAGTAGAGACAGGG + Intronic
906139262 1:43523874-43523896 TTTTTTCTTTAGTAGACTTAGGG - Intergenic
906612684 1:47214229-47214251 TCTTTTCCCTGGAGGACAGAAGG + Intergenic
906741378 1:48188799-48188821 TCTTTTCTTTTGGAGAGAGGAGG + Intergenic
906861555 1:49366147-49366169 TCTTTTTTTTTGAAGAATGAGGG - Intronic
907432195 1:54419338-54419360 TTTTTTTTTTAGAAGAGACAGGG - Intergenic
907538308 1:55186140-55186162 TCTATTTTTTGGAAGACTGAAGG - Intronic
907740669 1:57162741-57162763 ACTCTTGTTTAGAAGGCAGATGG - Intronic
907990922 1:59582075-59582097 TTTTTTCTTTTTAAGAGAGAAGG - Intronic
908061378 1:60353523-60353545 TACTTGCTTTAAAAGACAGAAGG - Intergenic
908075055 1:60507738-60507760 TCTGTTCTCTAAAAGACAGTGGG + Intergenic
908217420 1:61968280-61968302 GCTTTTCTTTAGAATACACATGG + Intronic
908222403 1:62020791-62020813 TCTGTTCTTTATAAGACACTCGG - Intronic
908664747 1:66477564-66477586 GTTTATGTTTAGAAGACAGAGGG - Intergenic
908974378 1:69879995-69880017 TCTATTCCTTAGAAGAGAGGAGG + Intronic
909072057 1:71006267-71006289 TCTTTTCTCACGAAGAAAGAGGG + Intronic
909499165 1:76314049-76314071 GCTTTTCTTTAGGAGCCAGAGGG + Intronic
909873098 1:80768489-80768511 TCTGTCCTTTAAAAGGCAGAAGG - Intergenic
910187958 1:84565239-84565261 TCTTTTATTTAGTTGACTGATGG + Intronic
910958264 1:92731346-92731368 TATTTTCTTTTTAACACAGAAGG + Intronic
911068261 1:93811408-93811430 TCCTTGCTTTCAAAGACAGAGGG + Intronic
911161865 1:94689322-94689344 GTTTTACTTTAGAAGACAGCTGG - Intergenic
911330971 1:96525372-96525394 TATTTTCCTTAGATGACTGAGGG + Intergenic
911626891 1:100133871-100133893 TCTTATTTTTAGTAGAGAGAGGG - Intronic
911735489 1:101332166-101332188 TGATTTCTGCAGAAGACAGAAGG + Intergenic
911796871 1:102087469-102087491 GCTTTTGTTTAGAGTACAGATGG + Intergenic
912158117 1:106947359-106947381 TCTTATCTTAATAAGATAGAAGG + Intergenic
912373321 1:109190463-109190485 TCTTATCTTTAGAGCACATATGG - Intronic
912908370 1:113731524-113731546 TCTTTTTTTTAAAATAGAGACGG - Intronic
912941833 1:114051854-114051876 AATTTTCTTTAGAATGCAGAGGG + Intergenic
913004421 1:114614836-114614858 TATTTTTTTTAGAAGAGACAAGG - Intronic
913222807 1:116672608-116672630 TCTCTTTTTTTAAAGACAGATGG - Intergenic
914837855 1:151223038-151223060 TATTTTTTTTAGAAGAGAGAGGG - Intronic
915173120 1:153992367-153992389 TTTTTTTTTTATAAGAGAGATGG + Intergenic
915241058 1:154522142-154522164 TCTTTCCTATAGAAGTCAGGAGG + Intronic
915859119 1:159423119-159423141 TTTTTTCTTTATACAACAGATGG + Intergenic
916156774 1:161858098-161858120 TCTTTTCTTTTTAAGACACAGGG - Intronic
916181413 1:162087072-162087094 TATTTTCTGCAGCAGACAGAGGG + Intronic
916460071 1:165014776-165014798 TCTACTGTTTAGAAGACTGAAGG + Intergenic
917560735 1:176152251-176152273 TTTTTTTTTTAGGAGAGAGAAGG - Intronic
918292365 1:183121244-183121266 TTTTTTTTTTAGAAGAGACAGGG - Intronic
918510221 1:185304525-185304547 GCTTTTCTTTAAAAATCAGAGGG - Intronic
918801673 1:188980608-188980630 TTTTTTCTTTAGAAGAAATAAGG - Intergenic
918911262 1:190573645-190573667 ACATTTCTTTAAAGGACAGAGGG + Intergenic
919426102 1:197433064-197433086 TTTTTTTTTTTGAAGAGAGACGG + Intronic
919527073 1:198666447-198666469 TATTTTCTTTATAAGATAAATGG - Intronic
919642799 1:200061630-200061652 CCATTTCTTTACATGACAGATGG + Intronic
919696052 1:200576817-200576839 TTTTTTCTTTTGTAGAGAGAAGG + Intronic
919718698 1:200809171-200809193 TCTTTTCTTGAGACCAGAGATGG + Intronic
919846470 1:201645738-201645760 TCTTCTCCTTAGCAGACAAAGGG - Intronic
919875087 1:201859652-201859674 TTTTTTCTTTTTAAGACAGATGG - Intronic
919917316 1:202146762-202146784 TCTGTTGTTTAGAAGCCACATGG + Intergenic
919968443 1:202553585-202553607 TCTGTTTTTGAGAAGAGAGAGGG + Intronic
920454775 1:206092092-206092114 TCTTTTCTTTTTAATAGAGATGG + Intronic
920514547 1:206575036-206575058 TTTTTTTTTTAGAAGAGACAGGG + Intronic
920887473 1:209944758-209944780 TTTTTTCTTTAAAAAAGAGAGGG - Intronic
920909870 1:210206319-210206341 TTTCTTCTTTAGTAGACACAGGG - Intergenic
920923785 1:210322340-210322362 TTTTATCTTTAGTAGAGAGAAGG - Intergenic
920990903 1:210938503-210938525 AATTTTATCTAGAAGACAGAGGG - Intronic
921469058 1:215526684-215526706 TGTTTGCATTAGAAGACAAACGG + Intergenic
921576733 1:216844057-216844079 TCTTTTCTTTAAAAAACTAAGGG + Intronic
921989297 1:221346947-221346969 TCTTTACAGTAGAAGACACAGGG - Intergenic
922502047 1:226104500-226104522 TCTTTTTATTATAAGACTGAAGG - Intergenic
924115308 1:240739455-240739477 TCTTTGCTTTAGAAAAAAGCTGG + Intergenic
924318359 1:242822041-242822063 TATTTGCTTTAGATGAGAGAAGG - Intergenic
924346452 1:243076923-243076945 TCTTTTCTTTTTAAGAGACAGGG - Intergenic
924354685 1:243159478-243159500 AATTTTCTTTAGAAGAAAAAAGG - Intronic
924402147 1:243695665-243695687 TACTTCCTTTTGAAGACAGATGG - Exonic
924926446 1:248688494-248688516 TATTTTAGTTAAAAGACAGAAGG - Intergenic
1062769363 10:87102-87124 TCTTTATTTAAGAAGACAAAAGG - Intergenic
1063241520 10:4174572-4174594 TTTTTTTTTTAGTAGACGGAGGG - Intergenic
1065060170 10:21891973-21891995 TATTTTCTTTATAACACTGAAGG - Intronic
1065353776 10:24819273-24819295 TCTTTTCTTTAAAGTAGAGATGG + Intergenic
1065713367 10:28538715-28538737 TTTTTTTTTTAGTAGACACAGGG - Intronic
1066053848 10:31662207-31662229 TCTTATCTTTAGTAGAGACAGGG + Intergenic
1066598926 10:37083271-37083293 TCTTTTCTTTAGTAGAGATGGGG + Intergenic
1066729894 10:38427922-38427944 TCTTTTCTTTTTAAGAGACAGGG + Intergenic
1068095739 10:52488933-52488955 TTTTTTCTTTCTAAAACAGATGG + Intergenic
1068647828 10:59488469-59488491 TTTTTTTTTTACAAGAAAGAAGG - Intergenic
1068914437 10:62413509-62413531 AGTTTTCCTAAGAAGACAGAGGG - Intronic
1069865926 10:71502869-71502891 TATTTTCTCTAGATGAGAGAAGG - Intronic
1070198893 10:74184335-74184357 TTTTTTCTTTTGTAGACACAGGG + Intronic
1070651476 10:78240076-78240098 TGTTTTATTTAGACAACAGACGG - Intergenic
1070910727 10:80115551-80115573 TGTTTTCCTTAAAATACAGAAGG - Intergenic
1071096040 10:81975992-81976014 TCTTTTCTTGAGATTTCAGAAGG + Intronic
1071309881 10:84332784-84332806 TTTTTTCTTTAAAATAGAGATGG - Intronic
1071750091 10:88465620-88465642 TGTTTTAGTTAGAATACAGATGG + Intronic
1072974409 10:100045024-100045046 TTTTTTCTTTCCCAGACAGATGG + Intronic
1073576865 10:104633389-104633411 TCTTTTCTTTAGGAGGTAAATGG + Intergenic
1073983238 10:109178439-109178461 TCTGTTCTTTAGAAGCCACCTGG + Intergenic
1076037620 10:127214019-127214041 TTTTTTCTTTAGCAGAGACAAGG + Intronic
1076217622 10:128709303-128709325 TCTTTCCTTTAGAATTCAAATGG - Intergenic
1078538514 11:12194610-12194632 ACATTTCTTTAGGAGAAAGAGGG - Intronic
1078657676 11:13256996-13257018 ACTATTCATTAGAATACAGAAGG + Intergenic
1078954956 11:16182905-16182927 TTTTTTTTTTAAAATACAGAAGG + Intronic
1079138861 11:17794225-17794247 ACTTTTCCTTAAAAGACAGATGG + Intronic
1079357156 11:19739173-19739195 TCTTTTCTTTTTTTGACAGAGGG - Intronic
1079581948 11:22076221-22076243 TATTTTCTTAAGAAAAAAGATGG - Intergenic
1079966875 11:26990750-26990772 TATTTTCTTTTGTAGACACAGGG - Intergenic
1080128273 11:28763687-28763709 TGTTTTCTTTATAAGTCAGTAGG + Intergenic
1080210329 11:29778560-29778582 TGTTATTTTTAGAACACAGAAGG - Intergenic
1080995856 11:37600594-37600616 TCTTTTCTTTATAAACCAGTGGG - Intergenic
1081136327 11:39444010-39444032 TTTTTTTTTGAGAAGACTGAAGG - Intergenic
1081560822 11:44214756-44214778 TTTTTTTTTTTAAAGACAGAGGG + Intronic
1082046194 11:47729732-47729754 TCTCTTCTTTAAAAGATAGCTGG + Intronic
1082788194 11:57328967-57328989 TCTTTTCATCAGAAGACTGTAGG - Intronic
1082910683 11:58370870-58370892 TATTTTCTTTAGGAGATAAAAGG - Intergenic
1083053778 11:59800451-59800473 CCTTTCTTTTAGAAAACAGAAGG - Intronic
1083116591 11:60465683-60465705 TTTTTGCTTTATAAAACAGATGG + Intronic
1083683686 11:64363141-64363163 GCTTTTGTTTAGATGTCAGACGG - Intronic
1084353294 11:68619023-68619045 TTTTCTCTTTAGAAGACAGGTGG + Intergenic
1085060217 11:73438963-73438985 TCTTTTCTTTGATAGGCAGAAGG + Intronic
1085165652 11:74397754-74397776 TTTTTTTTTTTGAAGAAAGAGGG + Intronic
1085450815 11:76631159-76631181 TTTTTTATTTGGAAGACAGCTGG - Intergenic
1086421510 11:86642145-86642167 TCTATTTTTTAGAAGACTTAGGG - Intronic
1086903528 11:92393976-92393998 TCTCTTCTTTAGGAAAAAGAGGG - Intronic
1087782876 11:102319607-102319629 TCTTTTCTTTGAGAAACAGAAGG + Intronic
1087819822 11:102699292-102699314 TTTTTTCTTTAGTAGAGACAGGG - Intronic
1087915591 11:103806120-103806142 AGTTTATTTTAGAAGACAGAAGG + Intergenic
1088421772 11:109656493-109656515 TCTTTTCTTTCCGAGAGAGAAGG - Intergenic
1088525410 11:110748030-110748052 TTTTTTTTTTAGGTGACAGAAGG - Intergenic
1088609555 11:111564177-111564199 ACTGTTCTTTGGAAGAAAGAAGG - Intergenic
1088661836 11:112054933-112054955 TCTTCTCTTAAGAGGACAGTTGG + Intronic
1088710696 11:112505861-112505883 TTTTTTTTTTAGTAGAGAGAGGG + Intergenic
1089127602 11:116187950-116187972 TCTTTTCTCCAGAAGAAAGTAGG - Intergenic
1089140781 11:116282181-116282203 TTGTATTTTTAGAAGACAGACGG + Intergenic
1089490948 11:118883727-118883749 TCTGTTTTTTTGAAGAAAGAGGG - Intergenic
1090046139 11:123335272-123335294 TCTTTTGTTATGAAGACAAAAGG + Intergenic
1090555698 11:127872668-127872690 GCATTTCTTTATAAGACAGTGGG - Intergenic
1090605321 11:128417014-128417036 TTTTTTCTTTTGAGGAAAGAGGG - Intergenic
1091124136 11:133081572-133081594 TCTCTTCTTGAGATGACAGACGG + Intronic
1091165763 11:133474755-133474777 TCTTTGCATGAAAAGACAGATGG + Intronic
1092035962 12:5334747-5334769 TTTTCTTTTGAGAAGACAGAGGG + Intergenic
1092305300 12:7294347-7294369 AATTTTCTTTAGTAGAAAGAAGG + Intergenic
1093641903 12:21537168-21537190 TTTTGTCTTTGGCAGACAGAAGG - Exonic
1095871064 12:47028647-47028669 TCTAGTCTTTAAAATACAGAGGG - Intergenic
1095968791 12:47887137-47887159 TCTTTTTTTTAGTAGAGACAGGG - Intronic
1096129738 12:49148512-49148534 TTTTTTCTTTAGTAGAGAGGGGG - Intergenic
1096288090 12:50317655-50317677 TTTTTTCTTTTTAAGAGAGATGG + Intergenic
1097677535 12:62619176-62619198 TCCTTTGTTTAAATGACAGATGG + Intergenic
1098259187 12:68650357-68650379 TCTTTTCTTTAGAAGTATAATGG + Intronic
1098710355 12:73750672-73750694 TGGTTTCTTAAGAAAACAGAGGG + Intergenic
1099946886 12:89255075-89255097 TCTTTTTTTGAGAAGAGACATGG - Intergenic
1100077398 12:90802476-90802498 TATTTTCTTTAGCAGAGACAGGG + Intergenic
1100198011 12:92269469-92269491 TTTTTTTTTTAGAAGAGACAGGG + Intergenic
1101304658 12:103515820-103515842 TCTATTTTTTAAAAGAAAGAAGG + Intergenic
1102398783 12:112610808-112610830 TCTTATCTTTAGTAGAGACAGGG + Intronic
1103102027 12:118185599-118185621 TCTATTCTTTAGAATACCTAAGG + Intronic
1103513121 12:121488978-121489000 TGTATTTTTTAGAAGAGAGAGGG + Intronic
1104393145 12:128408222-128408244 TATTTTCTATAAAATACAGATGG - Intronic
1104710404 12:130981895-130981917 TCTTTTTTCTGGAAGACACAAGG + Exonic
1105380407 13:19881812-19881834 TTTTTTATTTAGAATAGAGACGG - Intergenic
1105435752 13:20376821-20376843 TCATTTCTTTAGTAGAAAAATGG - Intergenic
1105590280 13:21786665-21786687 TATTTTCTTTAAAAGATATATGG - Intergenic
1106553508 13:30791168-30791190 TCTTTTGTTTAGTAGAGACAGGG + Intergenic
1107205909 13:37788120-37788142 TCTTTTCTTTTGAAATCAGAGGG - Intronic
1107701254 13:43050462-43050484 ACTTTTCTTTAGTAGAGACAGGG + Intronic
1107751231 13:43569626-43569648 TCTTTTCCTTAGAATATAAAGGG + Intronic
1109011956 13:56960775-56960797 TTATTTCTTTTGAAGAAAGAAGG + Intergenic
1109066118 13:57694512-57694534 TCTTTACTTCAGAAGATAAAAGG + Intronic
1109217913 13:59610953-59610975 TTTTTTCTTTAGTAGACAGGAGG + Intergenic
1109634120 13:65091123-65091145 TTTTTTCTTTAGTAGAGATAAGG + Intergenic
1109634237 13:65092568-65092590 TTTTTTGTTTTGAAGATAGATGG + Intergenic
1109797056 13:67329226-67329248 CCTTGTCTTTAGAAGAAAGGAGG - Intergenic
1110005190 13:70256903-70256925 TTTTTTTTTTAGAGGACTGAAGG - Intergenic
1110074910 13:71228050-71228072 TCTTGACTTTATTAGACAGAGGG - Intergenic
1110100979 13:71601599-71601621 TGTTTTGTTTAGAAAAAAGACGG - Intronic
1110164580 13:72424220-72424242 TCTTTTGTTTTGAAGACATTGGG - Intergenic
1110589196 13:77235110-77235132 TCTTTTATTTAGCAGACACTAGG + Intronic
1111131859 13:83987031-83987053 TTTTATCTTTGGAAGAGAGAAGG + Intergenic
1111510594 13:89256856-89256878 CCATTTCTTTAGCATACAGATGG - Intergenic
1112641968 13:101285476-101285498 TTTTTTTTTTACTAGACAGAGGG + Intronic
1112849173 13:103683283-103683305 TATTTACTTTAGGAAACAGATGG + Intergenic
1114452151 14:22834416-22834438 TCTTTTTCTCTGAAGACAGATGG - Exonic
1114591458 14:23868610-23868632 TCTTGTCCTTAGAAGACTGAGGG - Intergenic
1115179905 14:30611662-30611684 TCTTTTCTTTTTAAGAGATAAGG + Intronic
1116935874 14:50739605-50739627 TACTTTCATTAGAAGACTGAGGG - Intronic
1117139763 14:52776727-52776749 TCTTTTTTTTAGTAGAGACAGGG + Exonic
1117839241 14:59841521-59841543 TGTTTTCTTTAGTAGAGACAGGG - Intronic
1118013066 14:61629437-61629459 TCTTGCCTTGAGAAGAGAGACGG - Intronic
1118036003 14:61866800-61866822 TTTCTTCTGTAGAACACAGAAGG - Intergenic
1118125275 14:62895503-62895525 TATTTTCTTTAGTAGAGACAGGG + Intronic
1118471540 14:66079407-66079429 TCTTTTCTGTGGAAGCCAGAGGG + Intergenic
1119666245 14:76486951-76486973 TCTTTTATTTAAAACCCAGAAGG - Intronic
1119946063 14:78695765-78695787 TATTCTCTTGATAAGACAGATGG - Intronic
1121247745 14:92474868-92474890 TTTTTTTTTTAGTAGACACAGGG + Intronic
1121557618 14:94850285-94850307 TCTTTTCCTTAGTAGAGACAAGG - Intergenic
1124106143 15:26739889-26739911 TCTTATCTTCAGAAAACAAAAGG + Intronic
1124883715 15:33664471-33664493 TCTTTTCTTTTGAACACTTAGGG - Intronic
1125134206 15:36322789-36322811 ACTGTTCTTTAGAAGAGACATGG + Intergenic
1126031691 15:44505560-44505582 TCTTTTTTTTAGTAGAGACAGGG - Intronic
1126350842 15:47743387-47743409 TTTTTTCTTGAGAAGGCACAGGG + Intronic
1126447058 15:48758910-48758932 TCTTTTCATAAGAACATAGAAGG - Intronic
1126684980 15:51240679-51240701 ACTTTCCTTTTGAAAACAGAAGG - Intronic
1127111437 15:55676196-55676218 TCTTTTATTTATAATACTGAGGG + Intronic
1127863167 15:63011342-63011364 TCTTTTCATGGGAAGACTGAAGG - Intergenic
1128182237 15:65614069-65614091 ATTTTTTTTCAGAAGACAGAAGG - Intronic
1128415801 15:67444890-67444912 TCTTTTTCTATGAAGACAGATGG - Intronic
1128506992 15:68279586-68279608 TTTTTTCTTTTGAAGTCAGTAGG + Intronic
1129494861 15:75969334-75969356 TATTTTCTTTGGAAGGCAGCTGG - Intronic
1129628697 15:77233870-77233892 TCTTTTTTTTGAAAGACATAGGG + Intronic
1129637785 15:77340796-77340818 TCTTTACTTTAGAAACCAGCTGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131253895 15:90848730-90848752 TTTTTTCTTTAGTAGAGACAGGG + Intergenic
1131599763 15:93835305-93835327 TCTTTTCTTTTGAAAAAAGTGGG - Intergenic
1132794110 16:1710288-1710310 TTTTTTCTTTAGTAGAGACAGGG - Intronic
1133135054 16:3705241-3705263 TTTTTTTTTTAGTAGACACAGGG + Intronic
1133358460 16:5154529-5154551 TATTTTCTTTAGTAGAGACAGGG - Intergenic
1133521394 16:6561214-6561236 TCTTTTCCCTAGTAGACAGCAGG - Intronic
1133565193 16:6986727-6986749 TCTTTTCGTGACAAGAAAGAAGG + Intronic
1134421783 16:14099386-14099408 TTTTTTTTTTTTAAGACAGAGGG + Intronic
1134582782 16:15385420-15385442 ACTTTTCTTTAAAATAGAGATGG - Intergenic
1134585857 16:15410279-15410301 ACTTTTCTTTAAAATAGAGATGG - Intronic
1134814669 16:17196001-17196023 TCTTTTGTCCATAAGACAGAGGG - Intronic
1135147543 16:19975794-19975816 CCTTTTCTTCACAAGACAGCAGG + Intergenic
1135314106 16:21429488-21429510 ACTTTTCTTTAAAATAGAGATGG - Intronic
1135367031 16:21861766-21861788 ACTTTTCTTTAAAATAGAGATGG - Intronic
1135444785 16:22509394-22509416 ACTTTTCTTTAAAATAGAGATGG + Intronic
1135695175 16:24579832-24579854 TCTCTCCTTGAGAAGGCAGATGG + Intergenic
1136193507 16:28633936-28633958 ACTTTTCTTTAAAATAGAGATGG + Intergenic
1136310776 16:29408196-29408218 ACTTTTCTTTAAAATAGAGATGG - Intergenic
1136324218 16:29509974-29509996 ACTTTTCTTTAAAATAGAGATGG - Intergenic
1136438903 16:30249956-30249978 ACTTTTCTTTAAAATAGAGATGG - Intronic
1137532894 16:49294066-49294088 TCATTTATTTAGCAGACTGAAGG + Intergenic
1138160364 16:54747529-54747551 TCTTTTTTTTAGTAGAGACAGGG - Intergenic
1138478410 16:57285180-57285202 TCTTTTCTATAAAATACAGACGG - Intergenic
1138665902 16:58568191-58568213 TATTTTCTTTAGTAGAGACAGGG - Intronic
1138725113 16:59128173-59128195 TTTTTTCTTTTGTAGACACAAGG + Intergenic
1139282370 16:65781671-65781693 TCTTTTCTTTTTAATAGAGAAGG - Intergenic
1139858456 16:70000572-70000594 ACTTTTCTTTAAAATAGAGATGG - Intergenic
1140289563 16:73640067-73640089 TCATTTCTTCAGAAGACAGAAGG + Intergenic
1140377115 16:74453433-74453455 TCTTTTCTTTTGGAGAGGGAGGG + Intronic
1140521251 16:75584038-75584060 TCTTTTTTTTTAAAGACACAGGG + Intergenic
1140601922 16:76486709-76486731 AATTTTCTTTAGAGGAGAGAAGG - Intronic
1140608701 16:76572175-76572197 TATTTTCATTAAAAGAAAGAGGG + Intronic
1141738040 16:85868352-85868374 TTTTTTTTTTAGTAGACACAGGG - Intergenic
1141902671 16:87002843-87002865 TCTTTTCTCCAGAGGACACAGGG - Intergenic
1141921147 16:87136279-87136301 TCTTTTTTTTAGTAGAGACAAGG - Intronic
1142066442 16:88065645-88065667 TCTTTTGTTCAGAAAACTGATGG + Intronic
1142447204 16:90148751-90148773 TCTTTTCTTTTTAAGAGACAGGG + Intergenic
1142529533 17:570192-570214 TCTTTTTTTTAGTAGAGACAGGG - Intronic
1142820551 17:2463244-2463266 GCTTTTGATTAGAAAACAGATGG - Intronic
1143118550 17:4593805-4593827 TCTTCTCTGTGGAAGAGAGAGGG - Exonic
1143234846 17:5390708-5390730 TTTTTTTTTTAAAAGACACAGGG + Intronic
1143634645 17:8157444-8157466 TTTTTTTTTTAGAAGAGACAGGG - Intronic
1143678673 17:8458902-8458924 TTTTTTCTTTAGTAGAGACAGGG + Intronic
1144155475 17:12496232-12496254 TCTATTTTTAAAAAGACAGAGGG - Intergenic
1144244723 17:13351536-13351558 TCTTTTCTTTTGAATTCACAAGG - Intergenic
1144476844 17:15596058-15596080 TCTTTTTTTTAGTAGAGACAGGG + Intronic
1144921398 17:18767296-18767318 TCTTTTTTTTAGTAGAGACAGGG - Intronic
1145050855 17:19659363-19659385 TTTTTTCTTTTGTAGACACAGGG - Intronic
1145111111 17:20162318-20162340 TCTATTTTTTAGTAGACACAGGG + Intronic
1145852199 17:28111359-28111381 TTTTTTTTTTAGTAGACACAGGG + Intronic
1147839730 17:43362660-43362682 TTTTTTTTTTAGAAGAGACACGG + Intergenic
1148230967 17:45934831-45934853 TCTTTTCCTTGCTAGACAGAAGG + Intronic
1148432975 17:47657643-47657665 GCTTTACTTTAGAGTACAGATGG + Intronic
1148642199 17:49196294-49196316 TCTTTTATTTAAAATAGAGATGG - Intergenic
1149200294 17:54177814-54177836 TGGTTTCAGTAGAAGACAGACGG - Intergenic
1150598382 17:66627420-66627442 CCTTTTCTTTAAACAACAGAAGG - Intronic
1150935148 17:69627152-69627174 TTTTTTTTTTAGTAGAGAGAGGG - Intergenic
1151137194 17:71958197-71958219 CCTTTTTTTTAGTAGAAAGATGG - Intergenic
1151845813 17:76654591-76654613 TCTTTGATTTTGAAGACACAGGG + Intergenic
1151937531 17:77271953-77271975 TTTTTTTTTTAGTAGACAGGGGG - Intergenic
1152960422 18:76499-76521 TCTTTTCTTTTTAAGAGACAGGG + Intergenic
1153072980 18:1127555-1127577 TCTTTGATTTAGAAGACTCAAGG + Intergenic
1153447656 18:5192450-5192472 TCTTTTCTTTGGTAGAGACAAGG + Intronic
1153840829 18:9006216-9006238 TCTTTTCTTTTTAAGAGACAGGG - Intergenic
1155625842 18:27833710-27833732 ACATTTTTCTAGAAGACAGAGGG - Intergenic
1156031145 18:32713581-32713603 TATTTTCTTTATAATACAGATGG - Intronic
1156072697 18:33231953-33231975 TGTGTTCTTTAGAACAGAGATGG + Intronic
1156145424 18:34170361-34170383 TATTTTTTTTAGTAGAGAGATGG + Intronic
1156611666 18:38732143-38732165 TATTTTTTTTAGTAGAGAGAGGG + Intergenic
1156764180 18:40631387-40631409 TCTTCTCTTTAGAAGACATGAGG + Intergenic
1157083248 18:44551357-44551379 TTTTTTCTTTAAAAAACAGTTGG - Intergenic
1157710668 18:49847662-49847684 TCCTTTCCTTAGAAGTCAGTAGG - Intronic
1157773504 18:50372108-50372130 TCTTTTCTTTCAAAGTCAGCTGG + Intergenic
1157810647 18:50693081-50693103 TATTTTCTTTAGTAGAGACAGGG - Intronic
1158035194 18:53020145-53020167 GCTTTTCTTTAAAAGGTAGAAGG - Intronic
1158267588 18:55677310-55677332 CCAGTTCTATAGAAGACAGAGGG - Intergenic
1158497264 18:57967776-57967798 TCTTTTTTTTAGTAGAGACAAGG - Intergenic
1158693579 18:59683393-59683415 TCTTTTTTTAAAAAGACAGTTGG + Intronic
1158927855 18:62288188-62288210 TCTTTTATTTAAAAGGCAGAAGG + Intronic
1159620114 18:70627531-70627553 TTTTCACTTTATAAGACAGATGG - Intergenic
1160332503 18:78007587-78007609 TCTCTTATGTAGAAGAGAGAAGG + Intergenic
1160650003 19:219080-219102 TCTTTTCTTTTTAAGAGACAGGG - Intergenic
1160783065 19:886408-886430 CCTTTGCTTTAGAGGACAGTGGG + Intronic
1161157991 19:2744173-2744195 TTTTTTCTTTTGAAGAGACAGGG - Intergenic
1162069243 19:8143822-8143844 TTTTTTTTTTAAGAGACAGAGGG + Intronic
1162221902 19:9184220-9184242 TCTTTTTTTTAGTAGAGACAGGG - Intergenic
1163274359 19:16273816-16273838 TTTTTTTTTTAAGAGACAGAGGG + Intergenic
1163574983 19:18105524-18105546 TTTTTTTTTTAGAAGAGACAGGG - Intronic
1163995060 19:21037288-21037310 TCTTATTTTTAGTAGAGAGAGGG + Intronic
1164996350 19:32722215-32722237 TTTCTTCTTTAGAAGAGACAGGG + Intronic
1165508570 19:36251671-36251693 TGTTTTCTCTAGAAGACATTTGG + Intergenic
1166044515 19:40222224-40222246 TCTTTTATTGAGATGAGAGACGG + Exonic
1166111301 19:40624569-40624591 TTTTTTCTTTAGTAGAGACAGGG + Intronic
1166171627 19:41031634-41031656 TTTTTTTTTTAGAAGAGAAATGG - Intergenic
1166181299 19:41111055-41111077 TCTTTTTTTTAGTAGAGACAGGG + Intergenic
1166443864 19:42841213-42841235 TTTTTTTTTTTGAAGAGAGAGGG - Intronic
1166476483 19:43130403-43130425 TCTGTTCTCTAAAAGCCAGAAGG - Intronic
1166614229 19:44228665-44228687 TCTTTGCTCTTGAAGACAAAAGG + Intronic
1166709886 19:44930058-44930080 TTTTTTTTTTAGAAGAGACAGGG - Intergenic
1167283595 19:48586042-48586064 TTTTATTTTTAGAAGACATACGG - Intronic
1167470129 19:49670984-49671006 TATTTTTTTTAGTAGACACAGGG - Intronic
1168529442 19:57116141-57116163 TCTTTTCTTTTCAAGACATGGGG + Intergenic
1168619163 19:57863421-57863443 TCTTTTCTTTAGTAGAGACGGGG + Exonic
924964107 2:59568-59590 TCTTTTCTTTACAGGACTTAAGG + Intergenic
925291705 2:2752307-2752329 TCTCTTCTATAGAATGCAGAGGG - Intergenic
925883985 2:8378512-8378534 TCTATTCTTTCAAGGACAGAAGG - Intergenic
925934829 2:8746276-8746298 TATTTTCTTTAGTAGAGATAGGG + Intronic
926364209 2:12118164-12118186 TATTTTTTTTAGCAGAGAGAAGG + Intergenic
926388683 2:12364549-12364571 TCTTTCCTCCAGAAGAAAGAGGG - Intergenic
926498515 2:13621817-13621839 TCTTTTCAAAAGAAGATAGACGG + Intergenic
926872607 2:17439856-17439878 TATGTTCTTTAGAGGACAGGAGG + Intergenic
927504249 2:23602957-23602979 TCTTTTCCTAAGAAATCAGAGGG - Intronic
927617144 2:24610313-24610335 TCTTTTTTTTAGTAGAGACAGGG + Intronic
928208030 2:29301219-29301241 TCATTTTTTAAGAAGACAGAAGG - Intronic
928921204 2:36530000-36530022 TCATTTTTTTAAAAGAAAGATGG + Intronic
930286297 2:49432909-49432931 TTTTTCCTTTAGAAGAGATATGG + Intergenic
931481101 2:62641242-62641264 TTTTTTCTTTAAAAGAAAAAGGG - Intergenic
931619594 2:64196442-64196464 GGTTTTCTTTAGAAGAGACAGGG - Intergenic
931628554 2:64278565-64278587 TCTTTTATTTGGAACACAAATGG - Intergenic
931630916 2:64297805-64297827 CCTTTTCCTTGGAAGAGAGAGGG + Intergenic
931958910 2:67459684-67459706 TCTTTTCTTTATTAAAAAGAGGG - Intergenic
931970491 2:67580289-67580311 TCTTTTCATTGGAACAGAGATGG + Intergenic
932386728 2:71340954-71340976 TCTTTTCCTTATAAGTCTGATGG + Intronic
932846663 2:75142349-75142371 TCCTTTCTCAAGAAGGCAGAAGG + Intronic
933500474 2:83104490-83104512 TCTTTTTTTTAAAAAAAAGAAGG + Intergenic
933528810 2:83478860-83478882 TTATTTCTGTAGAAGGCAGAAGG + Intergenic
935163520 2:100549603-100549625 TTTTTTTTTTAGTAGAGAGATGG - Intergenic
935324176 2:101921041-101921063 TTTTATCTTTAGTAGACACAGGG + Intergenic
935441279 2:103099143-103099165 TTTTTTTTTTAGTAGACACAGGG - Intergenic
935627344 2:105182045-105182067 TCTAATCTTTACAAGGCAGATGG - Intergenic
936664817 2:114582056-114582078 ACTATTCTGTAGGAGACAGAAGG - Intronic
937605195 2:123792080-123792102 TCTTATCTGTAGAATGCAGATGG - Intergenic
938339428 2:130525629-130525651 TCTTTTCTTTTTAAGAGACAGGG - Intronic
938350410 2:130595123-130595145 TCTTTTCTTTTTAAGAGACAGGG + Intronic
938851739 2:135267454-135267476 TCTTTTTTTTAGAAGAGGGTGGG + Intronic
939416882 2:141911558-141911580 TAGTTTCTTGAAAAGACAGAAGG - Intronic
939797061 2:146658149-146658171 TCCTTTCTTTAGAAGGTAAAGGG - Intergenic
939929248 2:148212052-148212074 TCTTTTCTTTAAAAAACAGTGGG - Intronic
940019110 2:149138546-149138568 TCTTTTTTTAAGTAGACACAGGG + Intronic
940217324 2:151314550-151314572 TCTCTTATTTGGAAGACACAAGG - Intergenic
940352642 2:152706326-152706348 TTTTTTCATTAGAAGAAAAAGGG - Intronic
941105390 2:161346053-161346075 TTGTATTTTTAGAAGACAGAGGG + Intronic
941617424 2:167736727-167736749 TCTTTTTTTTAGTAGAAACAGGG - Intergenic
942015369 2:171808440-171808462 TTTCTTCTTTAGAGGCCAGAGGG - Intronic
942190658 2:173465588-173465610 ATTTTCCTTTAGAGGACAGAAGG + Intergenic
942467993 2:176229228-176229250 TCTTTTCTTTTGTAGAGACAGGG - Intergenic
942761790 2:179407459-179407481 TCTTTTGTTTAGTATACAAAGGG - Intergenic
943346723 2:186746911-186746933 TCATTTCTTTAGATGACACAAGG - Intronic
943602337 2:189937128-189937150 CCTTTTCTTTTGAAGAGACAGGG - Intronic
944187643 2:196967192-196967214 TCTTTCCCTTAGAAAACAGAAGG - Intronic
944201359 2:197110834-197110856 TCTTTTTTTTAGAGTAAAGATGG - Exonic
944448942 2:199821332-199821354 TTTTTTTTTTAGTAGACACAGGG + Intronic
944842647 2:203639085-203639107 TCTTTTTTTTAGTAGAGACAAGG + Intergenic
945314387 2:208355936-208355958 TCTTCTCTGTGGAAGACAGGAGG + Exonic
945497486 2:210526485-210526507 TCTTATCTGTAAAAGAGAGAAGG + Intronic
945831279 2:214789363-214789385 TTTTTTTTTTAGAAGAGATAGGG - Intronic
945941984 2:215959553-215959575 TCTCATCTTTGGAAGACAGCAGG - Intronic
945950058 2:216030733-216030755 TTTTTTTTTTAGTAGAGAGAAGG + Intronic
945987623 2:216368063-216368085 TCTTGTCTCTAGAAAACAGCAGG - Intronic
946124890 2:217553833-217553855 TTGTTTCTTGAGAAGAAAGAAGG + Intronic
946280974 2:218665237-218665259 TCTCTTTTTTAGAAGGCAGTCGG - Exonic
947162688 2:227229872-227229894 TATTTTTTTTAGTAGACACAGGG - Intronic
947300378 2:228682433-228682455 TCTTATCTTTAGAAAATAGGGGG + Intergenic
1169215540 20:3792238-3792260 TATATTCTTTAAAATACAGACGG + Intronic
1169609380 20:7362068-7362090 TATTTTCTTTGGTAGACAGGAGG - Intergenic
1169622449 20:7523083-7523105 TCTTTTCTGTAGAATACATTTGG - Intergenic
1173061643 20:39667276-39667298 TCTTTTTTTTAGTAGAGACAGGG - Intergenic
1173523972 20:43718145-43718167 TTTTTTTTTTAGTAGACAGAGGG - Intergenic
1173763849 20:45588248-45588270 GCTGTTCTCTAGAAGAGAGAAGG + Intergenic
1173967691 20:47125888-47125910 TTTTTTCTTTAAAAGAGAGAGGG + Intronic
1174162460 20:48561363-48561385 TCTTATTTTTAGTAGAGAGAGGG - Intergenic
1174400767 20:50274710-50274732 TTTTTTTTTTTTAAGACAGATGG - Intergenic
1175634982 20:60574329-60574351 CCTTTTGTTTAATAGACAGAAGG + Intergenic
1176335611 21:5595195-5595217 TCTTTGCTTCAGAGGATAGAAGG + Intergenic
1176392146 21:6225753-6225775 TCTTTGCTTCAGAGGATAGAAGG - Intergenic
1176469273 21:7090421-7090443 TCTTTGCTTCAGAGGATAGAAGG + Intergenic
1176492834 21:7472199-7472221 TCTTTGCTTCAGAGGATAGAAGG + Intergenic
1176507808 21:7666184-7666206 TCTTTGCTTCAGAGGATAGAAGG - Intergenic
1176546515 21:8204579-8204601 TCCATTTTTTAAAAGACAGACGG - Intergenic
1176554409 21:8248770-8248792 TCCATTTTTTAAAAGACAGACGG - Intergenic
1176565466 21:8387626-8387648 TCCATTTTTTAAAAGACAGACGG - Intergenic
1176573331 21:8431794-8431816 TCCATTTTTTAAAAGACAGACGG - Intergenic
1176911987 21:14577285-14577307 TTTTTTTTTTAGAAGAGACAGGG + Intronic
1177177603 21:17716978-17717000 TTTTTTCTTTGGAAGAGACAGGG + Intergenic
1177350274 21:19930371-19930393 TTTTTTTTTTAGAAAAAAGAAGG + Intergenic
1177976577 21:27859286-27859308 TATTTTCTTTAGTAGAGAGGGGG - Intergenic
1178292050 21:31377049-31377071 TTTTTTTTTTAGTAGACACAGGG + Intronic
1178437419 21:32572431-32572453 TTTTTTTTTTAGAAGAGATAGGG + Intergenic
1178536381 21:33413605-33413627 TGTTTTCTTTCTAAGACAAAGGG + Intronic
1179218095 21:39384430-39384452 TATTTTTTTTAGTAGAAAGAGGG + Intronic
1179249414 21:39660662-39660684 TCCTTTGTTTACAAGAAAGACGG + Exonic
1179341961 21:40520286-40520308 TATTTTCTCTTGAAGAAAGATGG - Intronic
1179805627 21:43835341-43835363 TCTCCTCTGCAGAAGACAGATGG - Intergenic
1182186759 22:28412175-28412197 TCTGTTCTTTAGAAGATGAATGG + Intronic
1182482751 22:30620149-30620171 TTTTTTTTTTAAAAGACAAAGGG + Intronic
1182575385 22:31269593-31269615 TTTTTTCTTTAGTAGAAACAGGG - Intronic
1182756538 22:32684224-32684246 TCCTTTCTTTTGAACACAGTTGG + Intronic
1182807512 22:33087070-33087092 TTTTTTCTTTTCAAAACAGAGGG + Intergenic
1182820065 22:33207975-33207997 TCTTTTCTTTAGACTGGAGAGGG + Intronic
1182920965 22:34078431-34078453 TGTTTTCTTAACAAGACAGGAGG + Intergenic
1183051942 22:35269969-35269991 TCTTCTCTTTAAAAGAGACAGGG - Intronic
1183067070 22:35370609-35370631 TTTTTTCTTTTGGAGAAAGAAGG - Intergenic
1183151716 22:36042810-36042832 TTTTTTTTTTAGAAGAGACAGGG + Intergenic
1183793501 22:40095448-40095470 ACTTTTCTTAAGAAGAGAGGTGG - Intronic
1203251378 22_KI270733v1_random:120841-120863 TCCATTTTTTAAAAGACAGACGG - Intergenic
949251979 3:1996151-1996173 TCTTTTCTTTAGCACAAATAGGG - Intergenic
949903627 3:8839994-8840016 TCTTCTCTGTCGGAGACAGATGG + Intronic
951043168 3:18010720-18010742 TTTTTTATTTAGAAGAGAAAAGG + Intronic
951619474 3:24585404-24585426 TCTTTTCCCTAGAACAGAGATGG + Intergenic
951988289 3:28645682-28645704 ACTTTTCTTTAGAATTCACAAGG + Intergenic
952097505 3:29971103-29971125 TCTTGTCTTTCTAAGAAAGATGG - Intronic
952590670 3:34949821-34949843 TCTCTTCTCTACAAGATAGATGG - Intergenic
952901365 3:38114098-38114120 TTTTTTTTTTAGTAGACACAGGG - Intronic
953124151 3:40075723-40075745 TCTCTTCTGTAGAAGAAAGGGGG + Intronic
953188081 3:40656714-40656736 TCTTTGCTTAATAAGACACAGGG + Intergenic
953271593 3:41450804-41450826 TCTTTTCCAGAGAAGACATATGG + Intronic
954141289 3:48607563-48607585 TTTTTTTTTTTTAAGACAGAGGG + Intronic
954141704 3:48610204-48610226 TTGTTTCTTTAGAAGAGACAAGG + Intronic
954920474 3:54186718-54186740 TTTTTTTTTCAGAAGACATAAGG - Intronic
956367211 3:68517381-68517403 CCTTTGTTTTAGAAGTCAGATGG + Intronic
956533088 3:70243145-70243167 TCTTGTCTGCAGAAGACAAAAGG - Intergenic
956547347 3:70419203-70419225 TTTTTTCTTTTGAAGAGATAGGG + Intergenic
957239353 3:77638684-77638706 TCTTTGATTTATAAGACAAATGG - Intronic
957528714 3:81412436-81412458 TTTTTTTTTTAGTAGAGAGAGGG + Intergenic
959041330 3:101425604-101425626 TCGGTTCTTTGGAAGAAAGAAGG - Intronic
959057641 3:101583833-101583855 TTTTTTTTTTAGTAGAGAGAGGG + Intronic
959358889 3:105366413-105366435 TATTCTCTTTACAGGACAGAAGG + Intergenic
959536298 3:107489203-107489225 TTTTTTCTTTTGTAGAGAGAGGG + Intergenic
959573957 3:107913735-107913757 TCTTTTGTTTAGAAGACATTGGG - Intergenic
959888965 3:111532884-111532906 TCTTTTTTTTGAAAGCCAGAGGG - Intronic
960170427 3:114454499-114454521 TTTTTTTTTTAGGAGACCGAGGG - Intronic
960772650 3:121211752-121211774 TATTTACTTTAGAAGAGACAGGG + Intronic
960876906 3:122305572-122305594 TCTTTTTATTAGAAGAGAAATGG - Intergenic
961105392 3:124236619-124236641 TCTTTTCTTTAGAATAAAGAGGG + Intronic
962114655 3:132490882-132490904 TGTTTTGTTTTGAAGACAAAAGG + Exonic
962511515 3:136105648-136105670 TCTTTTTTTTAAAAGAGATAGGG - Intronic
962677240 3:137765898-137765920 TCTTTTCTTCAGGGGACAAAAGG - Exonic
962821769 3:139055253-139055275 TCTTTTCTTTGGAAAATAGTGGG + Intronic
963244039 3:143043925-143043947 TATTTTTTTTAGAAGAGACAGGG + Intronic
963476467 3:145811564-145811586 TCTTTTGATTAAAAGACAGCAGG + Intergenic
963488871 3:145973413-145973435 TCTTTACTTTAGAACACACTTGG - Intergenic
965084934 3:164083417-164083439 TCTATAGTTTGGAAGACAGAAGG - Intergenic
965380003 3:167976761-167976783 TGTTTTCTTTAAAGGACATAAGG + Intergenic
967417151 3:189232049-189232071 TTTTTTCTTTATAAAACAAAGGG - Intronic
968309222 3:197668839-197668861 TCTTTTCCTTGAAATACAGAGGG - Intergenic
968310869 3:197682180-197682202 TCTTCTCTTTCTAAGATAGATGG - Intronic
968343357 3:197978816-197978838 TTGTATCTTTAGTAGACAGAAGG - Intronic
968367842 3:198201049-198201071 TCTTTTCTTTTTAAGAGACAGGG + Intergenic
968709033 4:2099175-2099197 CCTGTTCTTAAGAAGACAAAGGG + Intronic
968843599 4:3026555-3026577 TCTTTTCTTTTGTAGAGACAGGG - Intronic
969179580 4:5427427-5427449 TATTTTTTTTAGAAAATAGAAGG - Intronic
969269238 4:6087770-6087792 ACCTTTCTTTGGAAGACAAAAGG + Intronic
971343924 4:25795428-25795450 TTTATGCTTTAGAAAACAGAAGG + Intronic
971671776 4:29567779-29567801 TCTTTTCTTTACAAGATACATGG - Intergenic
971765274 4:30822787-30822809 TGGGTTCTTTAGAAAACAGAGGG - Intronic
972658871 4:41094522-41094544 ATTTAACTTTAGAAGACAGAAGG + Intronic
974229321 4:59089861-59089883 TCTATATATTAGAAGACAGAAGG + Intergenic
975046475 4:69810498-69810520 TGTTTTCTTTCAAAGACAGATGG - Intergenic
975521486 4:75306381-75306403 ACTTTGCTTTAAAAGCCAGAGGG - Intergenic
975627851 4:76367773-76367795 TCTTTTCTTTAACAATCAGATGG - Exonic
975852286 4:78584710-78584732 TCTTTTCTGTGGAGGACATATGG + Intronic
976498645 4:85760048-85760070 TTTTTTCTTCAGAAGAAATAAGG - Intronic
977222150 4:94350563-94350585 TCTTTTCTTTTTAAGACCAAGGG - Intergenic
977486634 4:97656295-97656317 CCTTTTATTTTGAAGACACAGGG - Intronic
977662547 4:99607751-99607773 TGTTTTGTTTAGAAAACAAAAGG + Intronic
977676943 4:99758405-99758427 CTTTTTCTTTAAAAGAAAGATGG - Intergenic
977806193 4:101300620-101300642 TCTATTTTTTAGTAGAGAGAGGG - Intronic
978450884 4:108832423-108832445 TCTTTTTTTTAGGGTACAGATGG - Exonic
978508923 4:109494281-109494303 TCTTTTTTTTAAAATAGAGATGG - Intronic
979445922 4:120811028-120811050 TATTTTCTTTACAAAAGAGAAGG - Intronic
979741600 4:124158124-124158146 TCTTCCCTATAGAGGACAGAAGG + Intergenic
979888965 4:126065593-126065615 TCTTCTCTTCAGTAGACAAAGGG - Intergenic
980026561 4:127775201-127775223 TTTTTTCTGTAGAAGAGAGCTGG + Intergenic
980397494 4:132233233-132233255 TCTTATCTTTTGGAGTCAGAAGG - Intergenic
980534615 4:134100963-134100985 TATTTTCCTTAGAAGATAAAAGG - Intergenic
980665787 4:135932307-135932329 TCCTGTCTTTAGAAGACAATTGG + Intergenic
981307151 4:143258874-143258896 TCTTTTCTTTACAACATAGGAGG - Intergenic
981654248 4:147093881-147093903 GATTTTCTTTTGAAGAGAGAAGG + Intergenic
981697484 4:147573572-147573594 TTTTTTATTTATCAGACAGAGGG - Intergenic
981705827 4:147658272-147658294 TGTTTTGTTTAGAAAATAGAGGG + Intronic
982201360 4:152964241-152964263 TATATTCTTCAGAAGACAAAGGG + Intronic
982649376 4:158067540-158067562 TTTTTTCTTTAGTAGAGACAGGG + Intergenic
982697553 4:158620603-158620625 ACTTTTTTTTAAAAGCCAGAAGG + Intronic
983994840 4:174169231-174169253 CCTGTTCTTGAGAGGACAGAAGG + Intergenic
984359519 4:178710868-178710890 TATTTTCTTTGGAAGTGAGATGG + Intergenic
984717734 4:182941575-182941597 TCTCCTCTTTAGAAACCAGAAGG + Intergenic
984994095 4:185411123-185411145 TTTTTTTTTTAAAAGACACAAGG + Intronic
986749051 5:10769545-10769567 TCATTTGTTGAGAAGAAAGATGG - Intergenic
987696427 5:21339968-21339990 TCTTTTCTGTAAATGACATATGG + Intergenic
988755773 5:34246598-34246620 TCTTTTCTGTAAATGACATATGG - Intergenic
989108144 5:37882603-37882625 TTTTTTCTTTTGAGGAAAGAGGG + Intergenic
989224170 5:39006659-39006681 TTTTTTCTTTAGAGGAAATAAGG + Intronic
990173394 5:53080561-53080583 TCTTTTCTTTGGTATACTGAGGG - Exonic
990322126 5:54640392-54640414 TCTTTTTTTTAAAAAAAAGATGG + Intergenic
990559252 5:56967110-56967132 TCTTTTCTTTATAATAGAGATGG - Intronic
991744029 5:69712426-69712448 TCTTTTCTGTAAATGACATATGG - Intergenic
991753679 5:69842812-69842834 TCTTTTCTGTAAATGACATATGG + Intergenic
991795601 5:70292158-70292180 TCTTTTCTGTAAATGACATATGG - Intergenic
991803296 5:70399537-70399559 TCTTTTCTGTAAATGACATATGG + Intergenic
991823401 5:70587696-70587718 TCTTTTCTGTAAATGACATATGG - Intergenic
991832996 5:70717933-70717955 TCTTTTCTGTAAATGACATATGG + Intergenic
991887969 5:71291671-71291693 TCTTTTCTGTAAATGACATATGG - Intergenic
992612012 5:78516032-78516054 CCTTCTCTTCAGAAGACAAAAGG + Intronic
992769541 5:80034951-80034973 TCTTCTTTTTAGAAAACAAAAGG + Intronic
993220313 5:85087134-85087156 TTTTTTTTTTAGTAGACAAAGGG - Intergenic
995290911 5:110452060-110452082 GCTTTACTTTAGAAGTAAGATGG - Intronic
995602546 5:113813629-113813651 GTTTTTCTTGTGAAGACAGATGG - Intergenic
995952105 5:117728564-117728586 TTTTTTCTTTAGAAGTAAAAAGG + Intergenic
996831498 5:127745137-127745159 TCCTGTCTGCAGAAGACAGATGG - Intergenic
997373155 5:133375185-133375207 TGTTTTCTTTGGAAAACAGCAGG - Intronic
998481817 5:142469317-142469339 TATTTTCTTTAGTAGAGACAGGG + Intergenic
998575167 5:143307436-143307458 TTTTTTCTTTTGATGAAAGAAGG + Intronic
998857198 5:146404894-146404916 TGTATTTTTTAGAAGACACAGGG + Intergenic
999224749 5:150011782-150011804 TTTTTTTTTTAGTAGACATAGGG + Intronic
999787006 5:154899919-154899941 TTTTTTTTTTAGAAGAAAGAAGG - Intronic
1000106810 5:158067699-158067721 TCTTTTTTTTTGTAGATAGAAGG - Intergenic
1000195262 5:158950947-158950969 TCTTCTCTTGAAAAGTCAGAAGG - Intronic
1001028127 5:168241432-168241454 TTTTTTTTTTAGTAGACACAGGG + Intronic
1001128269 5:169040546-169040568 TCTCCTCTTTGGGAGACAGACGG + Intronic
1002207349 5:177572613-177572635 TCTTTTCTTTTTAAGAGACAGGG + Intergenic
1002529163 5:179833634-179833656 CCACTTCTTTTGAAGACAGATGG - Exonic
1002727063 5:181306278-181306300 TCTTTTCTTTTTAAGAGACAGGG + Intergenic
1002981046 6:2138666-2138688 TCTTTTCTTTATAAGTTACACGG + Intronic
1003420142 6:5950215-5950237 TGTTTTCTTTAGAAGACATTTGG - Intergenic
1003455004 6:6274059-6274081 TCTTTTCTTTAGGAAACATCTGG - Intronic
1003534881 6:6968235-6968257 TTTTTAGTTTAGAAGGCAGAAGG - Intergenic
1003765339 6:9230047-9230069 TCTGTGCTTTAGAGGAAAGATGG - Intergenic
1003787466 6:9502952-9502974 TGTTTTATTTAGGACACAGATGG - Intergenic
1003996462 6:11545831-11545853 TTTTTTTTTTAGTAGACACAGGG - Intronic
1004390064 6:15202530-15202552 TTTTTTCTTTAGTAGAGACAGGG + Intergenic
1005554416 6:26958386-26958408 TCTTTTCTGTAAATGACATATGG - Intergenic
1005649236 6:27871426-27871448 TCTTTTTTTTAGTGGACAGGGGG + Intergenic
1006468632 6:34212371-34212393 TTTTTTTTTTAGTAGAGAGAGGG - Intergenic
1006635598 6:35459195-35459217 TCTTTTATTTAGAACTCACATGG - Intronic
1006691377 6:35889922-35889944 TTTTTTTTTTAGTAGACACAGGG - Intronic
1007053443 6:38857022-38857044 ACTTATCTATAGAAGAGAGAGGG - Intronic
1007951753 6:45878728-45878750 TGATTTCTTTAGAAAAGAGAGGG + Intergenic
1008754378 6:54776818-54776840 TCTTTTTTTTAGTAGAGATAGGG - Intergenic
1008893640 6:56525872-56525894 TTTTTTCTGAAGATGACAGAAGG - Intronic
1009326311 6:62352565-62352587 TCTTTTGTTTTTAAGACAGTTGG - Intergenic
1009778905 6:68243384-68243406 TGTTCTCTCTAGGAGACAGAAGG + Intergenic
1010208802 6:73346761-73346783 TGTATTCTTTAAAAGACAGATGG + Intergenic
1010249637 6:73694641-73694663 GCTTTACTTTAGCAGACAGTAGG - Intergenic
1010398615 6:75422398-75422420 CCTTTTCTTCAGAGGCCAGATGG - Intronic
1010615842 6:78011064-78011086 TCTTTAGTTGAGAAGACAGCAGG - Intergenic
1011050898 6:83148562-83148584 TCTTTTTTTTAAAACAGAGATGG - Intronic
1011103455 6:83750884-83750906 TTTTTTTTTTAGTAGAGAGAAGG - Intergenic
1011141245 6:84159752-84159774 TCTATTTTTTAGCAGAGAGAGGG + Intronic
1011820623 6:91249080-91249102 TCATTTCTTTAGAATGCACAAGG - Intergenic
1012056226 6:94414242-94414264 CCTTTTCTGTAGAAGACATATGG + Intergenic
1012113586 6:95264505-95264527 TATTATTTTTAGAAGAGAGAGGG + Intergenic
1012312986 6:97751227-97751249 TCTAGTTTTTAGAAGATAGAAGG + Intergenic
1012432663 6:99182196-99182218 TTTTTTTTCTTGAAGACAGATGG + Intergenic
1012556579 6:100520950-100520972 CCTATACTTTAAAAGACAGATGG - Intronic
1012671143 6:102049528-102049550 TCTTTCCTTTAATAGATAGATGG + Intronic
1012982056 6:105841176-105841198 ACTTGACTTTAGAAGACGGATGG - Intergenic
1013006338 6:106077717-106077739 CCCATTCTTTAGAAGACAGAAGG - Intergenic
1013109619 6:107054606-107054628 TGTTTTTTTTAAAAAACAGAAGG - Intergenic
1013338295 6:109187660-109187682 TTATTACTTTAGAAGAGAGAGGG + Intergenic
1013428524 6:110035829-110035851 TTTTTTCTTTCGTAGACACAGGG - Intergenic
1014055427 6:117009018-117009040 TCTATGCTTTAGGACACAGAGGG - Intergenic
1014366535 6:120550199-120550221 TTTATACTTTAGAAGACAGTGGG - Intergenic
1014397289 6:120940808-120940830 TCCTTTCTTTTGAAGAGGGAAGG + Intergenic
1014809128 6:125865858-125865880 TCTTTTCTTTTGTAGACACAGGG + Intronic
1015237146 6:130984741-130984763 TATTTTCTTAAGGAGACAGTGGG - Intronic
1015503459 6:133956965-133956987 TCTTTTCTTTAGAAGACAGATGG + Intronic
1015542318 6:134327750-134327772 TTTTTTCTTTAGAAAACATTAGG - Intergenic
1015835530 6:137416481-137416503 TGTTTTGTTTAAAAGACATATGG - Intergenic
1016381021 6:143480077-143480099 TCTTTTCTCTACAATAAAGAAGG - Intronic
1016754018 6:147663611-147663633 TTTTTTTTTTAGTAGACACAGGG - Intronic
1017526153 6:155242913-155242935 TCTTTTTTTTAGTAGAAACAGGG + Intronic
1017927208 6:158921010-158921032 TTTTTTCTTCAGAAGCCAGTTGG + Intergenic
1019296458 7:278347-278369 TCGTTGCTTTTGAAGACAGATGG + Intergenic
1019338984 7:499408-499430 TAGTTTCTTTAGAAGAGAGGAGG - Intronic
1021026537 7:15674600-15674622 TGTTGTCTTTAGAAAACAAAAGG + Intronic
1021416124 7:20387118-20387140 TCTTTTCTTGAGCAGACCTATGG + Intronic
1021862969 7:24925372-24925394 TCTTTTCTTGAAAAGACATCTGG - Intronic
1022253238 7:28629518-28629540 TCTTTGCTTTAAAAGATAGCAGG + Intronic
1022371932 7:29780188-29780210 TTTTTTTTTTTTAAGACAGAAGG + Intergenic
1022565361 7:31394511-31394533 TATTTAATTTAGAAGTCAGAAGG + Intergenic
1022633594 7:32109786-32109808 TCTTTTCTTTAGAGGGAAGAGGG + Intronic
1023637879 7:42230607-42230629 TCTTTTCTTTTAAATACAAATGG - Intronic
1023690825 7:42785562-42785584 TCGTTTCCTTAGAAGACAATAGG + Intergenic
1024414468 7:49087903-49087925 ACTTTACTTTGGAAGATAGAAGG + Intergenic
1024595238 7:50927845-50927867 TCTTTTCTTCATAATGCAGATGG - Intergenic
1025216099 7:57057896-57057918 TCTTTTTTTTAAAATAGAGATGG - Intergenic
1025655281 7:63512807-63512829 TCTTTTTTTTAAAATAGAGATGG + Intergenic
1025911391 7:65831739-65831761 TTTTTTTTTTAGTAGACACAAGG - Intergenic
1026556561 7:71413544-71413566 TTTTTTTTTTAGAAGAGACAGGG + Intronic
1026883344 7:73921137-73921159 TGTGTTATCTAGAAGACAGAGGG + Intergenic
1027442440 7:78233834-78233856 AATTTTCTTTTGAAGCCAGAGGG + Intronic
1027584367 7:80039675-80039697 TTATTTCTCTAGAAGACAGGGGG - Intergenic
1028278606 7:88892039-88892061 TCTTTGGTTTAGAAGAAAGATGG - Intronic
1029201337 7:98841157-98841179 TCTTTTTTTTTAAAGACACAGGG + Intergenic
1029391969 7:100281460-100281482 TCTTTTTTTTAAAAAAGAGATGG + Intergenic
1029540275 7:101178698-101178720 TTTTTTTTTTAGTAGAGAGAGGG - Intronic
1030255767 7:107507479-107507501 TTTTTTTTTTAGTAGACACAGGG + Intronic
1030335038 7:108316599-108316621 TTTTTTCTTTAGTAGAGACAGGG - Intronic
1030599224 7:111573486-111573508 TTTTTTTTTTAGTAGACACAGGG - Intergenic
1031128974 7:117808877-117808899 TATTTTCTTTTTAAGACACAGGG + Intronic
1031175586 7:118344451-118344473 TCTTTTGTTTTGAAGATACACGG + Intergenic
1031232833 7:119131885-119131907 TGCTTTCTTTAGCAGACTGATGG + Intergenic
1032048587 7:128631495-128631517 TCTTTTCTTTTTAAGAGACAGGG + Intergenic
1032600393 7:133287485-133287507 TGTTTTGTTTAGTAGAGAGAGGG + Intronic
1032886540 7:136145629-136145651 ACATTTCTTTAGAAGATACATGG + Intergenic
1034391926 7:150793769-150793791 ATTTTTCTCTTGAAGACAGATGG - Intronic
1034616076 7:152417939-152417961 TTTTTTTTTTAAAAGAAAGAGGG - Intronic
1034780651 7:153878793-153878815 TTTTTACATTAAAAGACAGAAGG + Intergenic
1034947812 7:155274887-155274909 GTTTTTGTTTAGAAGAAAGAAGG - Intergenic
1036104067 8:5821157-5821179 TCTTTTATTTTTAAAACAGAAGG - Intergenic
1036451735 8:8873734-8873756 ATTTTTGTTTAGAAAACAGATGG + Intronic
1037441798 8:18923750-18923772 CCCTTTCTTTAGATGACACATGG + Intronic
1037867914 8:22462234-22462256 TTTTTTCTTTTTAAGAGAGAGGG - Intronic
1038130246 8:24722584-24722606 ACTTTTGTTTACAAGACAGCAGG - Intergenic
1038227611 8:25671109-25671131 TTTTTTTTTTAAGAGACAGAAGG - Intergenic
1038258929 8:25976602-25976624 TCATCTCTTTAGAATACAAAAGG - Intronic
1038677256 8:29634596-29634618 TGAATTCTTTAGAAGACTGAGGG + Intergenic
1039095933 8:33885431-33885453 TTTTTTCTTTAGGAGAGAGAGGG + Intergenic
1039104685 8:33977514-33977536 TCTTTTCTCCAGAAAACACAGGG - Intergenic
1039283557 8:36012938-36012960 TTTTTTCTTTAGTAGAGACATGG - Intergenic
1039854621 8:41401584-41401606 TCTGTGGTTTAGAAGACAGAAGG - Intergenic
1039954866 8:42199432-42199454 TCTATTCTTTTGAAGACATGGGG - Intronic
1039998316 8:42554765-42554787 TGTTTTCTTTGGAAGAAAAATGG + Intergenic
1040497682 8:47981133-47981155 TTTTTTTTTTTAAAGACAGAGGG + Intergenic
1040730442 8:50440752-50440774 TCTTGACTTAAGATGACAGAAGG + Intronic
1040732564 8:50467207-50467229 TATTTTGTCTAGAACACAGAAGG - Intronic
1041393588 8:57369210-57369232 TCTTTTCTTTTGGAGGGAGAGGG - Intergenic
1041503378 8:58564477-58564499 ATTTTTCTTCAGAAGACAGATGG - Intronic
1041753973 8:61292526-61292548 TCTTTCCCTTTGAAGACAGAAGG + Intronic
1042599192 8:70481211-70481233 TCTTTTCTTTGGTAGAGACAGGG - Intergenic
1042780648 8:72487257-72487279 TTTTTTTTTTTGGAGACAGACGG - Intergenic
1043399349 8:79868627-79868649 TCCTTTGTTTATAAAACAGATGG - Intergenic
1044757210 8:95476626-95476648 TTTTTTCTTCAGAAGCCAAAGGG - Intergenic
1045180870 8:99780776-99780798 TATTTACTTTAGAATACACAGGG - Intronic
1045647739 8:104316067-104316089 TCTTATCTATACCAGACAGAGGG + Intergenic
1046484481 8:114868324-114868346 TCTTTACTCTGGAAGAAAGAGGG + Intergenic
1046964084 8:120143442-120143464 TATTTTTTTTAGCAGACACAGGG - Intronic
1047136092 8:122079982-122080004 GCTTATCTTCACAAGACAGAAGG - Intergenic
1047609140 8:126503929-126503951 TTTTTTCTTTAGTCCACAGAAGG - Intergenic
1047721041 8:127639700-127639722 TGTTTTCTTTTGATGACTGATGG - Intergenic
1047897385 8:129381906-129381928 TCTTCTCTTTTGAAAAAAGATGG - Intergenic
1048100127 8:131342059-131342081 TTTTTTCTTTTGAAGGCAGAAGG - Intergenic
1048654882 8:136524591-136524613 TATTATTTTTAGAAGAAAGAGGG + Intergenic
1048815927 8:138333545-138333567 TATTATCTTTAGAAAACAGTGGG - Intronic
1049566723 8:143344177-143344199 TCTGTGCTTGAGAAGACAGAAGG + Intronic
1049948310 9:619962-619984 TCTTATTTTTAGTAGACACAGGG - Intronic
1051428319 9:16957217-16957239 CCTTTTCTTTCAAAGACATAGGG + Intergenic
1051501927 9:17787264-17787286 TGTTGTCTTTAGAAGACAAGTGG + Intronic
1051755706 9:20397682-20397704 CCTTTCCTTAAGAAAACAGAAGG + Intronic
1051862778 9:21645508-21645530 TTTTTTTTTTAGTAGACACAGGG - Intergenic
1051950470 9:22625214-22625236 TTTTTTCTGTAAATGACAGAAGG + Intergenic
1052128394 9:24808346-24808368 TCATTCCTTTAGTAGACACATGG - Intergenic
1052732322 9:32303530-32303552 TCTTTTTTCTAGAATGCAGAGGG - Intergenic
1052823851 9:33161260-33161282 ATTTGTCCTTAGAAGACAGAGGG - Intronic
1052981593 9:34454135-34454157 TCCTTTCATAAGAAGACAGGAGG + Intronic
1053577477 9:39367378-39367400 TTTTTTTTTTAGTAGAGAGAGGG + Intergenic
1053841983 9:42195331-42195353 TTTTTTTTTTAGTAGAGAGAGGG + Intergenic
1054099052 9:60926095-60926117 TTTTTTTTTTAGTAGAGAGAGGG + Intergenic
1054120450 9:61201719-61201741 TTTTTTTTTTAGTAGAGAGAGGG + Intergenic
1054263003 9:62887854-62887876 TCTTTTTTTTTTAAGACAGTAGG + Intergenic
1054587299 9:66980837-66980859 TTTTTTTTTTAGTAGAGAGAGGG - Intergenic
1054887456 9:70214103-70214125 TCTTTCCTTTAGAATTCACAAGG - Intronic
1055094978 9:72403405-72403427 TCTTTTTTTTTTGAGACAGAGGG + Intergenic
1055398623 9:75899632-75899654 TCTTTTTGTTAGAAGATAGAAGG + Intronic
1055464083 9:76546706-76546728 TATTTTTTTTAGTAGACATAGGG + Intergenic
1055720483 9:79167708-79167730 TCTGTGCTTTAGAAAACCGATGG - Intergenic
1055810927 9:80146873-80146895 TATGTTCTTCAGAAGGCAGAAGG + Intergenic
1056245724 9:84693059-84693081 TGTTGTCTTAAGAAAACAGAAGG - Intronic
1056275984 9:84994697-84994719 TCTTTTATTTAGAGAACAGGGGG - Intronic
1056341775 9:85641869-85641891 TCTTATTTTTAGAAGAAACAGGG + Intronic
1057498704 9:95580094-95580116 TCTCTTCTTTTGAAGACTGTTGG + Intergenic
1057610801 9:96542021-96542043 TCTTTTATTTAAAAGTCAAAAGG - Intronic
1057636223 9:96770415-96770437 TTTTTTTTTTAGTAGACACAGGG - Intronic
1057846840 9:98532456-98532478 TTTTATCATTAGGAGACAGAGGG - Intronic
1058001769 9:99873065-99873087 TCTTTTCCTTAGGATCCAGAAGG + Intergenic
1058160275 9:101563110-101563132 TTATTTCATTAGAAGACAAAGGG - Exonic
1058659121 9:107252775-107252797 TCTTTTTTTTAGTAGAGACAGGG - Intergenic
1058667709 9:107335964-107335986 TCTTTTTTTTAGTAGAGACAGGG + Intergenic
1058706041 9:107638534-107638556 TCTTTTCTTTTTAATAAAGAAGG - Intergenic
1059613223 9:115921653-115921675 TCATTTCTTTAGAGCACAGTTGG + Intergenic
1059730652 9:117053730-117053752 TCTTTTCTTTACCAGAATGAGGG - Intronic
1059845198 9:118267913-118267935 GTCTTTCTTTAGAAGAAAGAAGG + Intergenic
1060836011 9:126755611-126755633 TCTTTGGTATAGAAGAAAGACGG + Intergenic
1061292995 9:129662969-129662991 TCATTCCCTTGGAAGACAGATGG - Intergenic
1062737674 9:138147207-138147229 TCTTTTCTTTTTAAGAGACAGGG - Intergenic
1062752183 9:138263754-138263776 TCTTTTCTTTTTAAGAGACAGGG + Intergenic
1203426028 Un_GL000195v1:39707-39729 TCTTTGCTTCAGAGGATAGAAGG - Intergenic
1203467780 Un_GL000220v1:103992-104014 TCCATTTTTTAAAAGACAGACGG - Intergenic
1203475605 Un_GL000220v1:147968-147990 TCCATTTTTTAAAAGACAGACGG - Intergenic
1185795778 X:2963093-2963115 TGCTTTGTTTAGAACACAGAAGG + Intronic
1186186530 X:7026039-7026061 TCTGTTCTCTAAAAGCCAGAAGG - Intergenic
1186491242 X:9974662-9974684 TCTTTTTTTTTGCAGATAGAAGG + Intergenic
1186553884 X:10536640-10536662 TCTTTTCTGTAGAATCTAGAAGG + Intronic
1187174569 X:16884503-16884525 TTTTTTTTTTAGTAGACACAGGG - Intergenic
1187515800 X:19968801-19968823 TCATTTCTTGATAAGACAAAAGG - Intronic
1188388336 X:29589806-29589828 TCTTTTCTTTAGAAATTAGTTGG - Intronic
1188456450 X:30372098-30372120 TCTTATCTATAGAAAACAGGTGG + Intergenic
1188698391 X:33226795-33226817 TTTTTTTTTTAAAAGACAGTGGG + Intronic
1188866604 X:35320639-35320661 TTTTTTATTTTGAAAACAGAGGG + Intergenic
1190466627 X:50731020-50731042 TCTCTTCTTTAAAAGATATAAGG + Intronic
1190534743 X:51414601-51414623 TGTTTTTTTTAGTAGAGAGAGGG + Intergenic
1190997050 X:55619941-55619963 TCTTTTTTTTATAAGAGAAAAGG + Intergenic
1191205438 X:57828384-57828406 TGTTTTTTTTAGTAGACACAAGG + Intergenic
1192591526 X:72363878-72363900 ACTGTTTTTTAGAAGAGAGATGG + Intronic
1193587431 X:83342607-83342629 TGTTTTCTTTACAAGACAATGGG + Intergenic
1194320002 X:92434546-92434568 TCTTTTCTTTTTAAGAGACAAGG + Intronic
1194409056 X:93534694-93534716 TCTTTTATTTATAAGGCAGAAGG - Intergenic
1194697580 X:97073913-97073935 ACTTTTCTTTAAAACACAGTAGG + Intronic
1194793093 X:98175378-98175400 AGTTTTCTTTAAATGACAGAGGG + Intergenic
1197103214 X:122680936-122680958 TCTTTTCTTTGGTTGACAGCTGG + Intergenic
1197339098 X:125244007-125244029 TTTTATCTTTAGTAGACACATGG - Intergenic
1197648316 X:129040677-129040699 TCTTTTTTTTAGTAGAGACAGGG - Intergenic
1197690657 X:129497331-129497353 ACTTTTATTTTGAAGGCAGAGGG - Intronic
1198301622 X:135339177-135339199 TCTTATCTGTTGAAGATAGAGGG - Intronic
1198625528 X:138568672-138568694 TCTTCATTTTATAAGACAGAAGG + Intergenic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1200628122 Y:5547680-5547702 TCTTTTCTTTTTAAGAGACAAGG + Intronic
1201375471 Y:13314131-13314153 TCTTCTATTTTAAAGACAGAGGG - Intronic
1201529747 Y:14978842-14978864 TCATTTGTGTAGATGACAGACGG - Intergenic
1201562006 Y:15327871-15327893 TCTGTTCTCTAAAAGCCAGAAGG - Intergenic
1201862884 Y:18618572-18618594 TCTTTGTTTTAGACTACAGACGG + Intergenic
1201870439 Y:18701806-18701828 TCTTTGTTTTAGACTACAGACGG - Intergenic