ID: 1015503789

View in Genome Browser
Species Human (GRCh38)
Location 6:133960675-133960697
Sequence CTTTGGGTATAGAGGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 328}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015503784_1015503789 29 Left 1015503784 6:133960623-133960645 CCTGAAACAATATTCTGAATTTG 0: 1
1: 0
2: 1
3: 38
4: 344
Right 1015503789 6:133960675-133960697 CTTTGGGTATAGAGGAAAAATGG 0: 1
1: 0
2: 1
3: 28
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015503789 Original CRISPR CTTTGGGTATAGAGGAAAAA TGG Intronic
900077796 1:832257-832279 CTTTGGCTATGAGGGAAAAAAGG + Intergenic
901093943 1:6663449-6663471 TTATGGGTATTAAGGAAAAAAGG + Intronic
901165709 1:7220337-7220359 CTTTGGGCCCAGAGGAATAATGG + Intronic
901899043 1:12342275-12342297 CTTTAGGGATAGAGGGAGAATGG - Intronic
902338748 1:15768797-15768819 ATTTAGGTATAAAGGGAAAAAGG - Intronic
902460233 1:16569410-16569432 CTCTGGGGACAGAGCAAAAATGG + Intronic
905112240 1:35604240-35604262 CTTTGGGTATAGATGGAGAATGG - Intronic
905118957 1:35666992-35667014 CTTTGGGAGTGGAGGAAGAAGGG + Intergenic
905655790 1:39685089-39685111 CTATTTGTATAGAGGAAAGAGGG - Intronic
905736485 1:40331005-40331027 CTTTGGATTTCCAGGAAAAAAGG - Intergenic
905950540 1:41946950-41946972 AGCTGGGTATAGAGGAACAACGG - Intronic
906303752 1:44703118-44703140 GTTTGAGGAGAGAGGAAAAAGGG + Intronic
909409456 1:75332475-75332497 TTTTGTGTATAAAGAAAAAAAGG - Intronic
911460396 1:98181991-98182013 CCTTTGGTATGGAGGAAAATGGG - Intergenic
911476930 1:98385135-98385157 CTCTGGGGAGAAAGGAAAAAAGG - Intergenic
913605184 1:120459171-120459193 CTCTGGGGACAGAGCAAAAATGG - Intergenic
913642050 1:120821908-120821930 CTCTGGGGACAGAGCAAAAATGG - Intronic
913989982 1:143602123-143602145 CTCTGGGGACAGAGCAAAAATGG + Intergenic
914189378 1:145395315-145395337 CTCTGGGGACAGAGCAAAAATGG + Intronic
914276430 1:146128456-146128478 CTCTGGGGACAGAGCAAAAATGG + Intronic
914366387 1:146982732-146982754 CTCTGGGGACAGAGCAAAAATGG - Intronic
914486060 1:148110715-148110737 CTCTGGGGACAGAGCAAAAATGG + Intronic
914537474 1:148579411-148579433 CTCTGGGGACAGAGCAAAAATGG + Intronic
914586392 1:149065863-149065885 CTCTGGGGACAGAGCAAAAATGG + Intronic
914628452 1:149485934-149485956 CTCTGGGGACAGAGCAAAAATGG - Intergenic
915621971 1:157091661-157091683 CCTGGGGTGTAGAGGAAAAGGGG + Intergenic
916347211 1:163807147-163807169 ATTTGGTTTCAGAGGAAAAATGG + Intergenic
917958367 1:180123494-180123516 CTTTGGGTAAAGAAGAAGAGTGG + Intergenic
918329502 1:183444452-183444474 CTTTGGGGAAATAGGAAAGAAGG + Intergenic
920814210 1:209315648-209315670 CTTTGGGTATAGGGTAGACAAGG + Intergenic
922495347 1:226053040-226053062 CTTTGGGTGTTCAGGAAACATGG + Intergenic
923176544 1:231472049-231472071 TCTTGGGTATTGTGGAAAAAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923914402 1:238485926-238485948 TTTTGGGTGAAAAGGAAAAATGG + Intergenic
924083462 1:240423590-240423612 CTTTGGGAGTACAGCAAAAAAGG - Intronic
924100380 1:240596883-240596905 CTTCGGGCAGAGAGAAAAAAAGG + Intronic
1063212032 10:3889319-3889341 CTCTGGGTACAGAAGTAAAAAGG - Intergenic
1064994234 10:21282384-21282406 CTTTGGTCACAGAGGCAAAAGGG + Intergenic
1065270823 10:24031747-24031769 GTTTGAGTAAAGAGGGAAAATGG + Intronic
1066706335 10:38183053-38183075 CTTTGGGGACACAGGGAAAAGGG - Intergenic
1067558935 10:47291010-47291032 ATATGGGTATAAAGTAAAAATGG - Intergenic
1068134995 10:52942984-52943006 CTTTCTGAATAGAGGAACAAGGG + Intergenic
1068355659 10:55905856-55905878 ATTTCAGTTTAGAGGAAAAAGGG + Intergenic
1068475332 10:57516712-57516734 ATGTGAGAATAGAGGAAAAACGG + Intergenic
1071795779 10:89003820-89003842 CTTTGAGTAGAGTTGAAAAAAGG + Intronic
1071868917 10:89770035-89770057 CTTTGGGTGCAGAGGCAAAATGG - Intronic
1073810519 10:107147669-107147691 CTCTTGGTATAGAAGATAAATGG - Intronic
1074246578 10:111699795-111699817 CTTTGGGTCAAGGGGCAAAAGGG - Intergenic
1074713066 10:116193438-116193460 CTTTGGGAATAAAAGATAAAGGG + Intronic
1076213500 10:128673365-128673387 CTCTGGGGATAGATGGAAAAAGG - Intergenic
1076548584 10:131262520-131262542 CTTTAGGTTTACAGAAAAAATGG + Intronic
1076772667 10:132675055-132675077 CTTTGGGTATGGAGGACTGAGGG - Intronic
1077621444 11:3728340-3728362 CTTAGGGTTTTGAGGAGAAAAGG + Intronic
1078360135 11:10661603-10661625 CTTTGAGGATGGAGAAAAAAGGG - Intronic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1079585014 11:22114799-22114821 CTTTGGGGATATAGGAAGGAGGG + Intergenic
1079619831 11:22540330-22540352 TTCTGGGTAGAGAGGAACAAGGG - Intergenic
1080219632 11:29886311-29886333 GTTTGTGTATAGAGGAAAAATGG - Intergenic
1080305590 11:30831370-30831392 CTTTGGGTAGAGGTGAGAAAGGG + Intronic
1080439613 11:32279841-32279863 GTGGGGGTATAGAGGAGAAAAGG + Intergenic
1080773194 11:35361664-35361686 CTTAGGGTAGAAAGGAATAAAGG + Intronic
1081542677 11:44047667-44047689 GTTTGGTTAAATAGGAAAAAAGG - Intergenic
1081552379 11:44125812-44125834 CTTTGTCTAGACAGGAAAAATGG + Intronic
1084639981 11:70419813-70419835 CTTTGAGTATCAAGGCAAAACGG + Exonic
1084939267 11:72603635-72603657 CTTTGGAATTAGAGGAGAAAGGG + Intronic
1086540169 11:87899609-87899631 ATTGGGGTAGAGAGGAATAATGG - Intergenic
1088992445 11:114965483-114965505 CTTTGGTTTTACAAGAAAAAAGG - Intergenic
1088993626 11:114976797-114976819 CTTTGGGTAGAAAGAAAAGAAGG + Intergenic
1090107072 11:123865459-123865481 ATTTGCGTTTAAAGGAAAAAGGG + Intergenic
1090432944 11:126661990-126662012 GTTTGGGTAAAGAGGAAAGAAGG + Intronic
1092183089 12:6459405-6459427 CTTAGGGTATATGGGAAAAAGGG + Intronic
1092345046 12:7707829-7707851 TTATGTGTATAGAGGAAACAGGG - Intergenic
1093730522 12:22560987-22561009 CTTGGGGTATAGAAGCAAATTGG + Intergenic
1094050483 12:26215239-26215261 TTGTGGGAATAGAGGAAGAATGG - Intronic
1094067021 12:26372084-26372106 CCTTGTGTATAAAGGAAAATAGG - Intronic
1094298089 12:28930414-28930436 TTGTAGGTATAGAGGAAACAAGG + Intergenic
1094806614 12:34100385-34100407 AGCTGGGTATAGAGGGAAAACGG - Intergenic
1096338128 12:50773266-50773288 CTTTGGGTATATACCAATAATGG + Intronic
1097728729 12:63104152-63104174 CTTTGGGTATAGAAATAATACGG - Intergenic
1097943209 12:65335667-65335689 ATTTGAGTAGAGAGGAAAACGGG - Intronic
1097951299 12:65431494-65431516 CGTTTGGTATAAAGGAAAAGGGG + Intronic
1098781767 12:74695987-74696009 CTTTGAGTATAAATAAAAAATGG - Intergenic
1098838602 12:75451834-75451856 CTTTGCCTATAGAGGAACAAAGG - Intergenic
1098884391 12:75945549-75945571 CTCTGGGTATACAGAAAAACTGG + Intergenic
1101975545 12:109354993-109355015 CATTTGGTATGGAGGAAAAGGGG + Intronic
1102119377 12:110429001-110429023 GTTTGTGGACAGAGGAAAAATGG + Intergenic
1102232099 12:111269785-111269807 CTTTGGGGAAAGAGGAGAGAGGG - Intronic
1102667459 12:114587608-114587630 CTTTGAGAACAGAGGAAATAGGG + Intergenic
1103403273 12:120657760-120657782 CTTTGGGTGTACAGGAGGAACGG + Intronic
1104070872 12:125344407-125344429 CTTTTGGGCTAGAGGGAAAAGGG + Intronic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1105599729 13:21875984-21876006 CTCTGGGGATAGAGAAAAATGGG + Intergenic
1105723119 13:23135472-23135494 GTTTGTGAACAGAGGAAAAATGG - Intergenic
1106147882 13:27067263-27067285 CTTTCGGTACAGAGAAAAAGAGG - Exonic
1108037930 13:46311617-46311639 CATTGGGCAAAAAGGAAAAAAGG + Intergenic
1108282532 13:48874304-48874326 CTCTGGGTGTGGAGGATAAAGGG - Intergenic
1108909951 13:55536041-55536063 CTATGGGTATACAGATAAAATGG + Intergenic
1109527985 13:63601272-63601294 CTTTGGGTATATACCAATAATGG + Intergenic
1110632512 13:77725726-77725748 CCTAGGGTAAAGAGGAAATAAGG - Intronic
1111756459 13:92402348-92402370 CTTTGTGGAAAGAGAAAAAAAGG - Intronic
1112556018 13:100469308-100469330 CTTTTGGCAAAGAGGAACAAAGG + Intronic
1112741338 13:102476457-102476479 CTGTAGGTGTAGAGCAAAAACGG - Intergenic
1113202188 13:107878134-107878156 CTTTGGGTAAAGAATAAAATTGG + Intergenic
1115851011 14:37590560-37590582 CTGTGGGTAGAGAGGACAAAGGG + Exonic
1116264499 14:42669906-42669928 CAGTGGTTATAGAGGACAAAGGG + Intergenic
1117969831 14:61240752-61240774 TTTTGGGTAAAAAGGACAAATGG - Intronic
1119009049 14:70964617-70964639 CTTTTTGTAAAAAGGAAAAAAGG - Intronic
1119529214 14:75347920-75347942 CTTTGACTATAAGGGAAAAAGGG + Intergenic
1119615321 14:76095209-76095231 CCTTGAGTCTAGAGGCAAAATGG + Intergenic
1120026729 14:79594397-79594419 ATTTGGGGACAGAGAAAAAAAGG + Intronic
1122250341 14:100434736-100434758 AGCTGGGTAGAGAGGAAAAAGGG - Intronic
1124809449 15:32920393-32920415 CCTTGGTTGTAGAGGAAGAATGG - Intronic
1126108494 15:45162308-45162330 CTTTGAGGATGGAGGCAAAAGGG - Exonic
1126212901 15:46119912-46119934 GCTTGGGGAAAGAGGAAAAAAGG + Intergenic
1126386743 15:48100999-48101021 CTTTGTTTATGGAAGAAAAAAGG - Intergenic
1126431736 15:48592923-48592945 CTCTGGGTGTAGAGAAACAATGG + Intronic
1127729588 15:61787223-61787245 CTTTTGGTATATAGAGAAAATGG - Intergenic
1128640970 15:69337054-69337076 CTATTGGAATAGAGGAAAAAAGG + Intronic
1129003574 15:72353829-72353851 ATTTGGGTACACAGGGAAAATGG + Intronic
1129065670 15:72901940-72901962 CTTTGGGTGGTGAAGAAAAATGG + Intergenic
1131330726 15:91496975-91496997 CTTTGGGGAAAGAGGTAAAGTGG - Intergenic
1131341626 15:91608008-91608030 CTTTGGGTATATATCCAAAAGGG - Intergenic
1132239096 15:100244002-100244024 GTCTGGGTATAAAGGAAAAGAGG + Intronic
1133329353 16:4962361-4962383 CTGTGGGTAGAGTGAAAAAAAGG + Intronic
1133850452 16:9498679-9498701 CTTTGGGGATAGCCAAAAAATGG + Intergenic
1135012039 16:18890202-18890224 CTTGGAGAATAGAGGTAAAAAGG - Intronic
1135318896 16:21477449-21477471 CTTAGAGAATAGAGGTAAAAAGG - Intergenic
1135371791 16:21909242-21909264 CTTAGAGAATAGAGGTAAAAAGG - Intergenic
1135439996 16:22461462-22461484 CTTAGAGAATAGAGGTAAAAAGG + Intergenic
1135861957 16:26064344-26064366 CTTAGGGTATAGAGGGTAGAAGG + Intronic
1136329200 16:29559515-29559537 CTTAGAGAATAGAGGTAAAAAGG - Intergenic
1136443831 16:30299227-30299249 CTTAGAGAATAGAGGTAAAAAGG - Intergenic
1138160446 16:54748288-54748310 CTTTGGGAACAGAGGAATTATGG - Intergenic
1138848848 16:60602253-60602275 CATTATGTATAGAGGCAAAAAGG + Intergenic
1139141094 16:64263621-64263643 CTTTGGCTGTCTAGGAAAAAAGG - Intergenic
1140863204 16:79037339-79037361 CTTTTTGTAGAGAGGAAGAATGG + Intronic
1140907859 16:79425073-79425095 CTTTGGGTATATGGGGAAAAAGG - Intergenic
1144409950 17:14991206-14991228 CTCGGGGTCTTGAGGAAAAATGG - Intergenic
1144418005 17:15069934-15069956 CTTTGGGTATAGTGGGGAATAGG - Intergenic
1144440408 17:15276251-15276273 CTTTTGGGTTACAGGAAAAAAGG - Intergenic
1145840338 17:27989077-27989099 CTTCGGGAACAGAGGAAAAAGGG + Intergenic
1147814813 17:43201496-43201518 CTGTGGCTAAAGAGGAAAATGGG + Intronic
1148447647 17:47747877-47747899 CTCTGAGTAGAGAGCAAAAAAGG - Intergenic
1149275047 17:55024602-55024624 CTTTGGGGTTAGAGAAACAATGG + Intronic
1149413856 17:56437613-56437635 ATTTAGCTATAGAAGAAAAACGG - Intronic
1151978363 17:77494988-77495010 CTTTGGGCAGAGAGGAAGAGAGG - Intronic
1154989179 18:21583984-21584006 CTTTGTGTAAAGAGAGAAAAAGG + Intronic
1155421179 18:25658286-25658308 CTATGAGGATTGAGGAAAAAGGG - Intergenic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1155725040 18:29070847-29070869 ATTTTGGTATAAAGGAAAGAAGG - Intergenic
1158442230 18:57486651-57486673 CTTTTGTAATAGATGAAAAAAGG + Exonic
1159510287 18:69389495-69389517 CTTTGGGACTTAAGGAAAAATGG + Intergenic
1159564146 18:70029140-70029162 CTTTGGCTAGGGAGGAAAAGAGG + Intronic
1164267953 19:23639225-23639247 CTTTGGGGATACAGGGAGAAAGG + Intronic
1165283568 19:34818023-34818045 TTTTGGGCCTGGAGGAAAAAAGG + Intergenic
1202676665 1_KI270711v1_random:13138-13160 CTCTGGGGACAGAGCAAAAATGG + Intergenic
924973984 2:156535-156557 AGCTGGGTATAGAGGAAAAACGG + Intergenic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
925501793 2:4513072-4513094 ATGTGGGTAGTGAGGAAAAACGG + Intergenic
926559529 2:14401003-14401025 CTTTGGGCAAAGAGGATAAAGGG - Intergenic
927374037 2:22392607-22392629 CTCAGGTTATAGAGGACAAAAGG - Intergenic
928690030 2:33789691-33789713 CTTGGGGTATAGGGAGAAAAGGG - Intergenic
929217287 2:39428694-39428716 CTTTGGATACATAGAAAAAATGG + Intronic
929357891 2:41048700-41048722 CTTTGGGTATGTAGAAATAAAGG - Intergenic
929480327 2:42300478-42300500 CTATGGGTATACAAGAAAACTGG + Intronic
929811829 2:45195333-45195355 GTTTGGGAAGAGGGGAAAAAGGG - Intergenic
930711815 2:54557374-54557396 GTTTAGGTAGTGAGGAAAAAGGG + Intronic
932289440 2:70563748-70563770 CTAAGAGTATAGATGAAAAAAGG + Intergenic
935810898 2:106796164-106796186 CTTTGGGCAGTGGGGAAAAAGGG - Intergenic
937795802 2:126018892-126018914 CTTAAGGTCTAGAGGAAAGATGG - Intergenic
938170344 2:129070208-129070230 CTTTGGCTAGAGAAGACAAAAGG - Intergenic
938694984 2:133826964-133826986 CTTTGGATACAAATGAAAAAGGG - Intergenic
939077302 2:137619213-137619235 CTTTGGATAAATTGGAAAAAGGG + Intronic
939292001 2:140207809-140207831 CTTTGGGTATATACCCAAAATGG - Intergenic
939350908 2:141036564-141036586 CTTTGCCTTTGGAGGAAAAAGGG - Intronic
941777786 2:169411531-169411553 CTTTGGGTATAGTCAAAAAAGGG - Intergenic
943366251 2:186970135-186970157 CTTTTTGTCTAGAGGGAAAAGGG - Intergenic
1169295400 20:4393050-4393072 CTTTGGGTATAGCGTAAGAGAGG + Intergenic
1169378351 20:5085612-5085634 CTTTGGGTAAAGATGTAAAGAGG - Intronic
1169378646 20:5087786-5087808 CTTTGGGTAAAGATGAGAAGAGG + Intronic
1169733499 20:8812124-8812146 CTTTGGGTATATAGCAAGCAAGG - Intronic
1171385785 20:24768639-24768661 CTTTGGGAAGAGAGAAAGAAGGG - Intergenic
1172410777 20:34721222-34721244 TTTTTTGTATAGAGGAAGAAGGG - Intronic
1173041206 20:39464728-39464750 CTGTGGGTAGAGGGGAAAAAAGG - Intergenic
1173686301 20:44925671-44925693 CCTTGTGTTTGGAGGAAAAAAGG + Intronic
1173975227 20:47181898-47181920 CTTGAGGTATGCAGGAAAAATGG - Intronic
1177661641 21:24091446-24091468 CTTTGGGGACACAGGAGAAAGGG + Intergenic
1178267033 21:31152994-31153016 TTGTTGGTAAAGAGGAAAAATGG - Intronic
1178319685 21:31595941-31595963 CTTTGGGGATGGAAGAGAAAAGG + Intergenic
1180233824 21:46444266-46444288 CTCTGGGTGGAGAGGGAAAAGGG + Intronic
1180672958 22:17567570-17567592 CGTTGGGTCTAGATGAAACAGGG - Intronic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
1183497960 22:38160892-38160914 CTTTGGGAAGAGGGGACAAAAGG + Intronic
1183766589 22:39882317-39882339 AGTTGGGGATAGAGGGAAAAAGG + Intronic
949633932 3:5961404-5961426 CTTTGTGTATACGGGTAAAATGG + Intergenic
950291899 3:11791372-11791394 CTTAGGGGAAAGAAGAAAAAGGG + Intronic
952599567 3:35063864-35063886 CATTGGTGGTAGAGGAAAAACGG + Intergenic
953581706 3:44163133-44163155 TTTTGGGTACACAGGAAGAATGG + Intergenic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
954515859 3:51175751-51175773 CTTTTGGTACAGAGAAAAGAAGG + Intronic
955995599 3:64677434-64677456 CATTGGGTACAGAGGAAACAAGG + Intronic
956260333 3:67332565-67332587 CTTTAGGCATAGAAAAAAAAAGG + Intergenic
957366651 3:79233278-79233300 CTTTGGGTGAAGTGAAAAAATGG + Intronic
957585052 3:82122405-82122427 CTCTAGCTATAGAAGAAAAAAGG - Intergenic
957720008 3:83982768-83982790 CTTTGGATGTAGAGCAAAAGAGG + Intergenic
958921106 3:100106516-100106538 CTTTGGGTAAAGAGTCAAAGTGG - Intronic
959347628 3:105219167-105219189 CTTTGGGGACTCAGGAAAAAGGG - Intergenic
960891687 3:122455171-122455193 CTTTGGGAATAGAGGAAGACAGG + Intronic
961214106 3:125146592-125146614 ATGTGGGAATAGAGGACAAAGGG + Intronic
961697810 3:128718093-128718115 CTGTGGGAAAAGAGGAGAAAAGG + Intergenic
963512398 3:146264078-146264100 CTTTGGGTAGAGAAGGAAAGAGG + Intergenic
963915922 3:150858755-150858777 AGCTGGGTATAGAGGAACAATGG - Intergenic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
966164259 3:176999412-176999434 CTGAGGATATAGAGGCAAAAAGG + Intergenic
966635634 3:182130098-182130120 CTTTGTGTATAGAGAAGAAGAGG + Intergenic
966822459 3:183935839-183935861 CTTTGGGTATTGAGGTAATAAGG - Intronic
966976998 3:185093620-185093642 CTGTGGGTATAGATGATACATGG + Intronic
967654346 3:192028596-192028618 CCTTATTTATAGAGGAAAAAAGG + Intergenic
968173673 3:196530064-196530086 CTTTGGGTATTCAGGGGAAAGGG - Intergenic
968987036 4:3881069-3881091 CTTTGTGGATAAAGGAAATAAGG - Intergenic
969127400 4:4962138-4962160 TTTAGAGTATAGGGGAAAAAAGG - Intergenic
969546635 4:7834342-7834364 CTTTGGGGATTCAGGGAAAAAGG + Intronic
969590193 4:8117636-8117658 CTTTGGGGCCAGAGGAAAAGTGG - Intronic
970083406 4:12316368-12316390 CTGTGGGGATAGAAAAAAAATGG - Intergenic
971035349 4:22687123-22687145 CTTGGCATATAGAGGAAAGAGGG - Intergenic
971498337 4:27291857-27291879 CCTTGGATTTAGGGGAAAAAAGG - Intergenic
971714255 4:30154867-30154889 CTTTAGGTTTTGAGGATAAAAGG + Intergenic
971814014 4:31463837-31463859 CTATTGGAACAGAGGAAAAAAGG - Intergenic
971821909 4:31568110-31568132 TTTTTGGCATAGAGGAAAATGGG - Intergenic
971842666 4:31874040-31874062 TTTTGGAAATAGAGTAAAAATGG + Intergenic
971865998 4:32173311-32173333 CTTGTGGTATAGAAGAGAAAGGG + Intergenic
973297299 4:48538873-48538895 CATTGAGTCTGGAGGAAAAAAGG - Intronic
974741108 4:66009057-66009079 CTTTGGGTATATACTAATAATGG + Intergenic
975329799 4:73100070-73100092 GTTTGTGAACAGAGGAAAAATGG - Intronic
976229412 4:82825693-82825715 TTTTAGGCAAAGAGGAAAAAAGG + Intronic
976471370 4:85432819-85432841 CTATGTGTATAGTGAAAAAATGG + Intergenic
977565748 4:98578790-98578812 CTTTGGATCTGGAGGAAAAGTGG - Intronic
977637788 4:99320205-99320227 CTTTGGGGACTGAGGGAAAAGGG - Intronic
977823679 4:101504914-101504936 CTTTGGGTTTAGGGGAGAGATGG + Intronic
978187312 4:105871863-105871885 CTTTGGGTGTAAAGGGACAATGG - Intronic
979327566 4:119397386-119397408 CATTGAGTATAGAGGAATTATGG + Intergenic
980245997 4:130243823-130243845 CTTTGGGTATATACCAATAATGG + Intergenic
980951553 4:139383908-139383930 ACTTGGGTATAGAGGAAGATAGG + Intronic
982839990 4:160172555-160172577 CTTTGGGTATATACCAGAAATGG - Intergenic
983330759 4:166325071-166325093 CCTTGGTAATAGAGGAACAAGGG + Intergenic
984551838 4:181170236-181170258 ATTTGGGTATAAAATAAAAATGG + Intergenic
985995215 5:3593918-3593940 TTTTGGGTATAGAGGAGAGGAGG + Intergenic
986953255 5:13117588-13117610 CTATGGGTACAGATGAAAAATGG - Intergenic
987452454 5:18103166-18103188 ACTTGGGTATAAAGGAGAAAAGG + Intergenic
988603356 5:32659378-32659400 CTTTGGGTATATAGCAGTAATGG + Intergenic
988716107 5:33829817-33829839 CTTTGGGAATTGAGGAAAGCTGG - Intronic
988895014 5:35663515-35663537 TTTTGGGTATGGAAGAATAAGGG - Intronic
991094190 5:62721834-62721856 CTTAGGGTAGAGAGGAAGAGAGG + Intergenic
993581284 5:89664582-89664604 TTTTAGGTAGAGAGGATAAAGGG - Intergenic
994476009 5:100270882-100270904 CTGTGGCTATAGCGAAAAAATGG - Intergenic
995058030 5:107783311-107783333 ATTTGGGTAAGGAGGAACAAGGG + Intergenic
995408852 5:111832178-111832200 CAGTAGGTACAGAGGAAAAAAGG + Intronic
996757091 5:126946621-126946643 CTTTGGGTTTCCAGTAAAAATGG + Intronic
996957607 5:129202889-129202911 AGTAGGGAATAGAGGAAAAAGGG + Intergenic
997414105 5:133711836-133711858 CCTTGGGCTTAGAGGAAAAATGG + Intergenic
997517503 5:134501463-134501485 CTGTGGGGACAGAGGAAAAGAGG + Intergenic
998269677 5:140695369-140695391 CCTTGGGGATAGTGGAAAAAAGG + Intronic
998862686 5:146459478-146459500 CTTTTGGGTTAGAGGAAAACAGG + Intronic
999910432 5:156192064-156192086 CTCTGGGAAAAGAGGAAAAATGG - Intronic
1000385418 5:160670546-160670568 CATTGGGGTCAGAGGAAAAAAGG + Exonic
1000601234 5:163277359-163277381 GTTTGGTTATAGAGCAACAAAGG - Intergenic
1000934342 5:167289851-167289873 ATTTAGGTATAGTGGAAAAATGG - Intronic
1000964314 5:167637461-167637483 CTTTGGGTATATACCAATAATGG - Intronic
1002839484 6:893749-893771 CTGTGGGGACAGAGGAAGAAAGG - Intergenic
1003068514 6:2924377-2924399 CTTTAGGTAGTGAGGAAACACGG - Intergenic
1004785168 6:18960531-18960553 CTTTGGGGAGAGAGAGAAAAAGG - Intergenic
1006474548 6:34245822-34245844 GTTTGTGAACAGAGGAAAAATGG - Exonic
1007447740 6:41920269-41920291 TCTTGGGTCTAGAGGAAAAAAGG - Intronic
1008138894 6:47809088-47809110 TTTTGGGTCTTTAGGAAAAATGG - Intronic
1008228053 6:48946474-48946496 CATTGGGTAGAGCCGAAAAATGG + Intergenic
1008251169 6:49241619-49241641 CCTGGGGAATAGAGGAAGAATGG + Intergenic
1008444094 6:51568614-51568636 GTATGAGTATAGAGAAAAAATGG + Intergenic
1010730137 6:79382317-79382339 CATTGGGCATAGAGAAAAACTGG + Intergenic
1010928535 6:81772754-81772776 ATTTGGGTTTAGGGGGAAAATGG + Intergenic
1012487175 6:99735315-99735337 ATCTGGGTCTAGAGGATAAAGGG + Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013591659 6:111623833-111623855 CTTTGGGCAAATAGGAAGAATGG - Intergenic
1014601919 6:123423873-123423895 CTTTAAGTAAAAAGGAAAAAAGG - Intronic
1014853805 6:126374359-126374381 CTTTGGGTTTAGAAATAAAATGG + Intergenic
1014997321 6:128165332-128165354 CTGTATGTAAAGAGGAAAAAGGG - Intronic
1015177702 6:130328899-130328921 TTATGAGTATAAAGGAAAAATGG + Intronic
1015503789 6:133960675-133960697 CTTTGGGTATAGAGGAAAAATGG + Intronic
1015763270 6:136687910-136687932 CTTTGGGTATATACCAATAATGG - Intronic
1016344472 6:143097645-143097667 ATTTGAGGATAGAGGAAAACAGG - Intronic
1018011059 6:159670547-159670569 CTATGATTATAGAGGATAAATGG - Exonic
1018474704 6:164129270-164129292 CTTTGAGGATAGAGGAAAACAGG + Intergenic
1018542527 6:164898035-164898057 CTTTGGGGGTGGGGGAAAAAAGG - Intergenic
1018663055 6:166106049-166106071 GTTGGGGTATAGAAAAAAAAAGG - Intergenic
1020185852 7:5958949-5958971 CTTGGGGTGTAGATGAAGAAGGG - Intronic
1020297064 7:6765813-6765835 CTTGGGGTGTAGATGAAGAAGGG + Intronic
1020431247 7:8118589-8118611 ATTTGGGTCTAGAAGGAAAATGG - Intronic
1020494870 7:8837331-8837353 CTTTGGGTATATAGCACAAATGG - Intergenic
1020744877 7:12068399-12068421 CTTTAGTTGTAGAGGGAAAAGGG - Intergenic
1021067576 7:16195871-16195893 CTTTGGATGCAGAGGAACAAAGG - Intronic
1021402790 7:20228835-20228857 CTTTGGGGATAATGGAAAGAGGG + Intergenic
1021638937 7:22719373-22719395 CTTTGGGAGAAGAGGTAAAATGG - Intergenic
1021793379 7:24228299-24228321 CTTTGGGGGTAGGGGTAAAAAGG - Intergenic
1022426668 7:30275762-30275784 ATTGGTGTATAGAAGAAAAATGG + Intergenic
1022563672 7:31375221-31375243 CTGTGGGTACAGAGGTAAATGGG - Intergenic
1024111196 7:46147852-46147874 CTTTGGGTATATACGCAAAATGG + Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1026182644 7:68055642-68055664 CTTTGGGTATTGGGGAATATTGG + Intergenic
1028462481 7:91111206-91111228 ATTTGGGTAGAGAAGGAAAAAGG - Intronic
1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG + Intronic
1033103106 7:138493914-138493936 TTTTGGGAAAAGGGGAAAAATGG - Intronic
1033192958 7:139299401-139299423 TTTTGTGTATAAAAGAAAAAAGG - Exonic
1033767308 7:144507689-144507711 ATTTCGGAATACAGGAAAAAAGG - Intronic
1035527827 8:327380-327402 CTTTGGCTATGAGGGAAAAAAGG - Intergenic
1039769922 8:40674984-40675006 CTTCGGGTATTGAGGAAGAGTGG - Intronic
1040860409 8:51993211-51993233 CTTTGGGTATATAGCCATAATGG - Intergenic
1042071252 8:64937466-64937488 CTTTGGTTAGAGAGTAAAAAGGG + Intergenic
1043842004 8:85117435-85117457 CTTGGGGTAAAGAGTAAACATGG + Intronic
1044126276 8:88461499-88461521 CTTTGGGTATATACCCAAAATGG + Intergenic
1044325288 8:90851564-90851586 TTGTGGGTATAGAAAAAAAAGGG + Intronic
1046227299 8:111300047-111300069 ATTTGTGAATATAGGAAAAAGGG + Intergenic
1046440702 8:114249841-114249863 CTTTGGGGACAGCGAAAAAAAGG + Intergenic
1047593224 8:126349463-126349485 CTTTGGGTACAGGGGAGGAAGGG + Intergenic
1047645459 8:126865415-126865437 CTTTTGGTATCTAGGAAAGAAGG - Intergenic
1048300306 8:133246358-133246380 CTTTGGGGATAGAGGGACCAGGG - Intronic
1048941572 8:139404715-139404737 CTGTGGCTATAGTGGAGAAAAGG + Intergenic
1050740716 9:8816791-8816813 CTTTAGGAATAGAAGAAGAAAGG + Intronic
1051096483 9:13471829-13471851 CTTTGGGTATATACCAATAATGG + Intergenic
1052000062 9:23267355-23267377 CCTGTGGTATAGAGGAAGAATGG + Intergenic
1052069347 9:24063048-24063070 CTTAGGGAAGACAGGAAAAATGG + Intergenic
1052661767 9:31442060-31442082 CTTTGGGTATATAATCAAAAAGG - Intergenic
1053137483 9:35660536-35660558 CTCTGGGGATAAGGGAAAAAAGG - Exonic
1054981012 9:71206096-71206118 CTTTGGGTATATACCAGAAATGG + Intronic
1055204202 9:73708046-73708068 CTTTGGTGAGATAGGAAAAAAGG - Intergenic
1056884296 9:90425815-90425837 GTTTAAGTATAGAGGGAAAATGG - Intergenic
1057195286 9:93112977-93112999 CTTGGGGTCTAGAAGACAAAAGG - Exonic
1058219830 9:102284792-102284814 CTTTGGGGATTGAGGGGAAAAGG + Intergenic
1186077510 X:5897356-5897378 CTTTGGGAATAGGAGAAAAAGGG - Intronic
1186725895 X:12358431-12358453 ATTTGGTGATAGAGGAAATATGG + Intronic
1188799187 X:34505978-34506000 CTGTGACTATAGAGGAGAAAAGG - Intergenic
1189497922 X:41526297-41526319 CTTTGGGGATAGAAGCAAATAGG - Intronic
1189561129 X:42192425-42192447 CTTTGAGTATATATAAAAAAAGG - Intergenic
1190728989 X:53212276-53212298 TTTTAGCTAGAGAGGAAAAATGG - Intronic
1191904991 X:66077958-66077980 CTTTGGATAGAGTGGAAGAAAGG - Intergenic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1194689456 X:96964978-96965000 CTTAGAGGATAGAGGAATAAAGG + Intronic
1194983550 X:100465686-100465708 GTTTTGGAAAAGAGGAAAAATGG - Intergenic
1195798706 X:108682394-108682416 CTTTGGGTATATACCAAAATGGG + Intronic
1196527190 X:116740472-116740494 AGCTGGGTATAGAGGGAAAACGG + Intergenic
1196991694 X:121336250-121336272 ATTTGGGGACAGAGGAAAACAGG + Intergenic
1197183708 X:123563347-123563369 TTATGGGTCTAGAGGTAAAATGG - Intergenic
1197418389 X:126205362-126205384 CTTGCTGTATAGAGGAAAAAAGG + Intergenic
1197999111 X:132413466-132413488 CTTAAGGTAAAGAGGTAAAATGG - Intronic
1199223821 X:145348562-145348584 CATTTGGTAGAGACGAAAAAGGG + Intergenic
1199391197 X:147281278-147281300 CTTTGGTTTTAGAGGTGAAAAGG - Intergenic
1199391416 X:147283976-147283998 CTTTGGTTTTAGAGGTGAAAAGG - Intergenic
1199391634 X:147286675-147286697 CTTTGGTTTTAGAGGTGAAAAGG - Intergenic
1200876677 Y:8163488-8163510 CTTTGGCCATGGAGGAACAAAGG + Intergenic
1201057038 Y:10004435-10004457 CTTTGGCCATGGAGGAACAAAGG - Intergenic