ID: 1015504222

View in Genome Browser
Species Human (GRCh38)
Location 6:133964830-133964852
Sequence TAGCATAGACAACCTGTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015504222_1015504225 -4 Left 1015504222 6:133964830-133964852 CCTTAAACAGGTTGTCTATGCTA 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1015504225 6:133964849-133964871 GCTAGAGCATTTTATATGAGGGG No data
1015504222_1015504223 -6 Left 1015504222 6:133964830-133964852 CCTTAAACAGGTTGTCTATGCTA 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1015504223 6:133964847-133964869 ATGCTAGAGCATTTTATATGAGG 0: 1
1: 0
2: 1
3: 84
4: 744
1015504222_1015504224 -5 Left 1015504222 6:133964830-133964852 CCTTAAACAGGTTGTCTATGCTA 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1015504224 6:133964848-133964870 TGCTAGAGCATTTTATATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015504222 Original CRISPR TAGCATAGACAACCTGTTTA AGG (reversed) Intronic
906148551 1:43574403-43574425 TAGCATAAATAACATTTTTAAGG + Intronic
907366007 1:53960658-53960680 TAGCACATACCACCTCTTTAGGG + Intronic
907610193 1:55861357-55861379 TAGCATAGCCAACAGATTTAGGG + Intergenic
910589672 1:88917263-88917285 AAGTTTAGAGAACCTGTTTAAGG - Intergenic
911138653 1:94471935-94471957 TAGGAAAGACACCCTCTTTAAGG + Intronic
915083106 1:153365592-153365614 TAGGATAGAGAAACTGTTTCAGG - Intergenic
916453941 1:164951039-164951061 TAGCTTAGATAATCTGTTCATGG + Intergenic
918497329 1:185156074-185156096 TAACCGAGGCAACCTGTTTACGG - Intronic
923471173 1:234292315-234292337 TTGCATAGACAACATGGTCAGGG + Intronic
1065505257 10:26424051-26424073 TAGCAGGGACAAACTGTGTAAGG + Intergenic
1068010415 10:51442810-51442832 TAGCATAGCCAACCTCTTAGTGG + Intronic
1077878415 11:6327173-6327195 TGTCATAGACATCCTGTCTACGG + Intergenic
1078452726 11:11452560-11452582 AAGCATAGACCACTTGTCTATGG - Intronic
1081473549 11:43400985-43401007 TAGCAAAGAAAACTTGTTAAGGG - Intronic
1082198683 11:49335728-49335750 TAGCATAGAAAAGCCATTTAGGG + Intergenic
1092683755 12:11017788-11017810 GAGCAGAAACATCCTGTTTAAGG + Intronic
1094099848 12:26750488-26750510 AAGTATAGACGACCTGTTTGGGG - Intronic
1094567023 12:31608432-31608454 TAGCAGGGACAAGCTGTGTAAGG + Intergenic
1096958968 12:55558545-55558567 TAGTTTAGAAAACCTATTTAAGG + Intergenic
1097786902 12:63770652-63770674 TAGCAGGGACAAACTGTGTAAGG - Intergenic
1099112765 12:78583001-78583023 AAGCAAAGACAAACTCTTTATGG - Intergenic
1099318891 12:81119649-81119671 TAGCATAGACAGCCTATAAATGG - Intronic
1100239932 12:92701085-92701107 TAGCATAGACATACTTTTTAAGG + Intergenic
1100680385 12:96913291-96913313 TGACAAAGCCAACCTGTTTAAGG - Intronic
1106430838 13:29678889-29678911 TGGCATAGAAATCCTCTTTATGG - Intergenic
1107600287 13:42005921-42005943 AAGGATAGAAAACTTGTTTATGG - Intergenic
1109031038 13:57188286-57188308 TATCATAGACAAACTGATTCTGG - Intergenic
1113265280 13:108609456-108609478 TAGCATTGAGCACCTGTTTGGGG - Intronic
1118722657 14:68605420-68605442 TAGCAGGGACAAACTGTGTAAGG - Intronic
1121435410 14:93915931-93915953 CAGCATAGACAATATGTCTATGG + Intergenic
1121474493 14:94184700-94184722 AAGCATAGAGAAAGTGTTTAGGG + Intronic
1124722564 15:32122624-32122646 TAGCATACACAAACATTTTAGGG - Intronic
1137051323 16:35715259-35715281 TAGCAGGGACAAGCTGTGTAAGG - Intergenic
1137343750 16:47636275-47636297 TAGCAGTGGCAACCTGTCTAGGG + Intronic
1140824434 16:78692680-78692702 GATCATAAACAACCTATTTATGG - Intronic
1147970368 17:44216229-44216251 TAGCATGGACAACCAGGTTGAGG - Intronic
1148164537 17:45474015-45474037 TTGCATAGATAATCTTTTTATGG - Intronic
1150271011 17:63865121-63865143 TAGCATAAACAACCAGCTCAGGG + Intergenic
1150395758 17:64820670-64820692 TTGCATAGATAATCTTTTTATGG - Intergenic
1165686142 19:37821858-37821880 TAGGATACACAACATTTTTAAGG - Intergenic
926034223 2:9622279-9622301 GAACAAACACAACCTGTTTATGG - Intronic
926200789 2:10795450-10795472 TAGCAGAGACAACGTGTCCAAGG + Intronic
929351332 2:40959405-40959427 TACAATAGATAATCTGTTTATGG + Intergenic
935931503 2:108132012-108132034 AGTCATAGACCACCTGTTTATGG - Intergenic
938879157 2:135567192-135567214 TAGCAGGGACTACCTGTCTACGG - Intronic
938995783 2:136676029-136676051 TAGCATAGACTATCTCTGTAAGG - Intergenic
939378380 2:141400367-141400389 TAGCCTATACGACTTGTTTAAGG + Intronic
941298766 2:163774713-163774735 AAGCATAGAAATGCTGTTTAAGG - Intergenic
941778441 2:169418338-169418360 TAAATTAGACAACCTGTTTTGGG - Intergenic
942784152 2:179681351-179681373 TAGCATAACCAAACTGTTCAGGG + Intronic
944759945 2:202804324-202804346 TAGCAGGGACAAGCTGTGTAAGG + Intronic
1175707807 20:61193763-61193785 TAGCAAAGACAAAATGTGTAAGG - Intergenic
951542277 3:23793183-23793205 AAGCATAGAATAACTGTTTATGG + Intergenic
958745209 3:98125997-98126019 TACCAAAGCCAACCTGTCTAGGG - Intergenic
958748023 3:98161390-98161412 TACCAAAGCCAACCTGTCTAGGG - Intergenic
958751816 3:98200904-98200926 TACCAAAGCCAACCTGTCTAGGG - Intergenic
958881194 3:99672722-99672744 TAGCAGAGACTCCCTGCTTAAGG - Intronic
963733536 3:148993913-148993935 TAGCTTAATCAACCTGTTGAAGG + Intronic
964392758 3:156214349-156214371 TAGCATAGACCCCCAGATTAAGG - Intronic
968053595 3:195673735-195673757 CAGCACAGACACCCTGTTGAGGG + Intergenic
968102218 3:195974627-195974649 CAGCACAGACACCCTGTTGAGGG - Intergenic
970894836 4:21089876-21089898 TAGAATAGACAACCAGTATAGGG - Intronic
971761315 4:30769608-30769630 TAGTATAGACAACATGTAAACGG - Intronic
979298390 4:119058241-119058263 TTGCATAGACTACCTATTAATGG - Exonic
991461341 5:66862442-66862464 TACCATAGACAATAAGTTTATGG - Intronic
991547744 5:67802308-67802330 TATCATAGACATCCTGATTCTGG + Intergenic
993704777 5:91157230-91157252 TAGCTTTGACAAGTTGTTTAGGG - Intronic
994432391 5:99684073-99684095 TTTCATAGAAAGCCTGTTTAAGG + Intergenic
999419029 5:151425108-151425130 CAGCAGAGTCAACCTGTTAATGG + Intergenic
1004047746 6:12042630-12042652 TAGAATAGAAAACATGTTGACGG - Intronic
1007027842 6:38596149-38596171 CAGCATTGAGAACCTGTCTAAGG + Intronic
1011954283 6:93005913-93005935 CTGCATAGACAAGCTGTTGAGGG + Intergenic
1013992609 6:116272019-116272041 TAGCATAGAAAACTTTTTTATGG - Intronic
1015504222 6:133964830-133964852 TAGCATAGACAACCTGTTTAAGG - Intronic
1016076782 6:139805238-139805260 TGCCATAGACAACATGTTGATGG - Intergenic
1016225934 6:141737652-141737674 TAACCTAGAGAACCTGTTTTTGG + Intergenic
1018032912 6:159857617-159857639 CAGCATAGAAAACCTATTTAAGG - Intergenic
1023327124 7:39072394-39072416 TTGCTTAGACAAATTGTTTAAGG - Intronic
1026478409 7:70757752-70757774 CAGCAGTGACTACCTGTTTAGGG - Intronic
1032188054 7:129744579-129744601 TAGCATAGCCAAATTGTTAATGG - Intronic
1035551791 8:533596-533618 TTGCAAAGACTACCTGTTTAAGG - Intronic
1042068027 8:64900289-64900311 CAGCATTGACTACATGTTTATGG + Intergenic
1043136798 8:76537593-76537615 TAACATACAAAACATGTTTAAGG + Intergenic
1044472957 8:92592885-92592907 TAGCTTAGATCACCTGCTTAAGG + Intergenic
1046481782 8:114829375-114829397 TAGCATAGACTTTCTGTGTATGG + Intergenic
1048309672 8:133311030-133311052 AAGCAAAGAGAATCTGTTTAAGG - Intergenic
1048963898 8:139601274-139601296 TAGCCCAGACAACCTCTTAAAGG - Intronic
1049716143 8:144093749-144093771 TAGCAGGGACAAGCTGTGTAAGG + Intergenic
1052057028 9:23917903-23917925 TAACATACACAACCCGTTCAAGG - Intergenic
1052194026 9:25690318-25690340 TAACATAGAAAACATATTTAAGG - Intergenic
1059744696 9:117188696-117188718 GAGAATAAACAACTTGTTTAAGG + Intronic
1186500973 X:10050319-10050341 TGCCACAGACAACCTGTTTTGGG + Intronic
1188741086 X:33782807-33782829 TAGCAAACACAACTTTTTTATGG - Intergenic
1189202586 X:39210288-39210310 TAGCATAGACTTCCAGTTTCTGG - Intergenic
1191089484 X:56604482-56604504 TAGAATAGACACCCCTTTTAGGG - Intergenic
1193126421 X:77875297-77875319 TACCATAGACATCCTGAGTAAGG + Intronic
1196728813 X:118921560-118921582 CAGCATTGACAACCTGATTGGGG - Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1199391044 X:147279327-147279349 TACCACAGACAACATGTTTAAGG + Intergenic
1199391262 X:147282018-147282040 TACCACAGACAACATGTTTAAGG + Intergenic
1199391480 X:147284716-147284738 TACCACAGACAACATGTTTAAGG + Intergenic
1202071433 Y:20995767-20995789 TAGGAGAAACAACCTGTCTAAGG + Intergenic