ID: 1015505837

View in Genome Browser
Species Human (GRCh38)
Location 6:133986761-133986783
Sequence ATTTTGTTCTGGGCAATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015505837_1015505840 1 Left 1015505837 6:133986761-133986783 CCTTTAATTGCCCAGAACAAAAT 0: 1
1: 0
2: 0
3: 16
4: 228
Right 1015505840 6:133986785-133986807 TGTATTACTTTTACTTATTATGG 0: 1
1: 0
2: 3
3: 48
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015505837 Original CRISPR ATTTTGTTCTGGGCAATTAA AGG (reversed) Intronic
900499524 1:2994626-2994648 ATTTTGTTCTGAGCACTCTAGGG - Intergenic
907001471 1:50863387-50863409 TTTTTGATCTAGGCATTTAATGG - Intronic
907642404 1:56204394-56204416 ATTATGTGCTGGGCACTGAATGG + Intergenic
908956543 1:69636600-69636622 ATTTTGTTTTTGGCTATAAAGGG + Intronic
911174177 1:94802697-94802719 TTGTTGTTCTGGACAGTTAAGGG - Intergenic
911673039 1:100628789-100628811 ATTCTGTTCTAGGCTATTTAAGG + Intergenic
912746174 1:112247411-112247433 TGTTTGTTCTGGGCCATTGAGGG - Intergenic
912785684 1:112601585-112601607 AATTTGTTCTGGGAAAATCAGGG + Intronic
913409877 1:118539725-118539747 ATTTTCTCCTGGCCAATTAGAGG + Intergenic
913709819 1:121471938-121471960 TTTTTATTCTGGACAATTAATGG - Intergenic
914975527 1:152357341-152357363 ATATAGTTCTGGGCACTCAAGGG - Exonic
915774124 1:158464117-158464139 ATTTTGTCTTGGGAAATTATTGG - Intergenic
916669592 1:167002337-167002359 ATTATGTTTAGGGAAATTAAAGG - Intronic
917698817 1:177559066-177559088 TTCTTGATCTTGGCAATTAAAGG + Intergenic
919255939 1:195125281-195125303 ATTTTCATCTGCACAATTAAAGG + Intergenic
920712196 1:208306001-208306023 ATTTTGATCAGGGCCATAAAGGG + Intergenic
921723256 1:218496762-218496784 CTTATGTTCTGGGCATTTAGGGG + Intergenic
923903799 1:238359948-238359970 TTTTTTTTCTGGGTAATGAAAGG - Intergenic
924086009 1:240452331-240452353 ATTTTTTTCTGACTAATTAAAGG - Intronic
1064266067 10:13826496-13826518 TTTTTCTTCTGGCCAATAAATGG - Intronic
1064970119 10:21057049-21057071 ATTTTGCTTTTGGCATTTAATGG - Intronic
1065051484 10:21797051-21797073 ATTTTCTTCTAGGCATTTTATGG + Intronic
1065602934 10:27388241-27388263 ATTTTGTTTAGGGCAATTTTAGG + Intergenic
1066127827 10:32359120-32359142 ATTTCATTCTAGGCAATTCAAGG + Intronic
1066448529 10:35506849-35506871 AATTTGTGCTGGCTAATTAAGGG - Intronic
1067129756 10:43552412-43552434 ATTTTCTTCTAGGCACTTTATGG + Intergenic
1068170551 10:53387825-53387847 ATTCTGTTCTGAGCAACAAAAGG + Intergenic
1068810802 10:61253898-61253920 ATTTTTATGTGGGCATTTAATGG + Intergenic
1069113946 10:64480702-64480724 CTTTTCTTCTTGGCAATTCAGGG - Intergenic
1069114061 10:64482636-64482658 ATTGTGTTTAGGTCAATTAAAGG - Intergenic
1070337353 10:75467332-75467354 ATATTGTGCTGGTCAAATAATGG - Intronic
1070749218 10:78954138-78954160 GATTTGTTCTGGCCAATGAAAGG - Intergenic
1071090358 10:81911249-81911271 ATTTATTTTTGGGCAAATAATGG + Intronic
1071163580 10:82779445-82779467 ATTTTGGTCAGAGCAACTAAAGG - Intronic
1071366336 10:84904196-84904218 ATTTTGTTATGGGCTATTGATGG + Intergenic
1072340420 10:94442859-94442881 TTTTTCTTCTGAGCAATAAAAGG - Intronic
1073996605 10:109322918-109322940 AGTCTGTTCTGTCCAATTAAAGG - Intergenic
1074955253 10:118382456-118382478 CTGTAGTTCTGGGCAATTTACGG + Intergenic
1075575653 10:123575597-123575619 ATTTTGTTGTTTGCAATCAAAGG - Intergenic
1077768900 11:5193119-5193141 ATTTTGTTCTGGGTATTTTGTGG + Intergenic
1078771516 11:14357114-14357136 TTTTTGTTTTGGGGAAGTAATGG - Intronic
1078864614 11:15285588-15285610 ATTTTGTTCATGGAAATTACTGG + Intergenic
1079826492 11:25201684-25201706 ATTTTGTTTTAGACAATCAATGG + Intergenic
1079866208 11:25737955-25737977 ATTTTGTTCTGGCCCATTTATGG + Intergenic
1080534121 11:33205198-33205220 ATTTTATTTTGGGAAAATAAAGG - Intergenic
1085240239 11:75047201-75047223 TTTTTGATGTGGGCATTTAATGG + Intergenic
1085614750 11:77988289-77988311 ACTTTGTTCTGGGCACTGGACGG - Intronic
1086953346 11:92912731-92912753 ATCTTGTTGTTGTCAATTAATGG - Intergenic
1087510053 11:99080607-99080629 ACTTTGTTCTGGCCACTTAAGGG - Intronic
1088533563 11:110836640-110836662 ATGCTGTTCTGGTCAAATAAGGG - Intergenic
1089661269 11:119987251-119987273 ATTTTATGCTGGGCAAATATGGG - Intergenic
1093507659 12:19887267-19887289 GTTTAGTTGTGGACAATTAAGGG + Intergenic
1094095863 12:26703863-26703885 ATTTTGTTCCCTGCAATGAAAGG - Intronic
1095650502 12:44603193-44603215 TTTTTTTTCTGTGCAAATAATGG - Intronic
1096847768 12:54417504-54417526 CTGTTGTTCTGGGCTATTCAAGG - Intronic
1097859555 12:64505079-64505101 ATTTTTTTCTGGATAATTTATGG - Intergenic
1097871301 12:64604495-64604517 ATTTTGTTCATGGCAATGACAGG - Intergenic
1098009804 12:66038659-66038681 ATTTTTTTCAGGTCAATAAAAGG - Intergenic
1098552627 12:71780265-71780287 ATTTTTTTCTAGGTATTTAATGG - Intronic
1099248827 12:80227043-80227065 CTTTTGTGCTGGGCACTTGATGG + Intronic
1100028427 12:90157055-90157077 ATTTTGTTCTAAATAATTAAAGG + Intergenic
1101060613 12:100967679-100967701 ATTTTATTTGGGGCTATTAAAGG - Intronic
1101210117 12:102526886-102526908 ATTTTGATGTAGGCAATTCAAGG + Intergenic
1102365096 12:112326565-112326587 ATTTTTTTCTGGGAAAATACTGG + Intronic
1104182075 12:126391357-126391379 ATTTAGTTGTGGGCCATTCACGG - Intergenic
1105868777 13:24485545-24485567 AGTTTCTTCTGAGTAATTAATGG + Intronic
1106797970 13:33227089-33227111 ATTTTGTTATGGCCATTTAAAGG - Intronic
1107719534 13:43233326-43233348 ACTTTCTTCTTGACAATTAATGG - Intronic
1107769224 13:43772240-43772262 ATTTTGTTCTGAGAAAGTCACGG + Intronic
1107795251 13:44045289-44045311 ATTTTATTATGGGTCATTAAGGG - Intergenic
1108202277 13:48055974-48055996 ATTTTGTTGTGAGAAAATAAAGG + Intronic
1108775168 13:53757236-53757258 ATTTTCTTCTGGGACATTGAAGG + Intergenic
1109203983 13:59461499-59461521 ACTTTGTCCTGGGCAGTTAGGGG - Intergenic
1111838707 13:93422638-93422660 CTTTTGTTCTGAGCAAATATTGG - Intronic
1112262382 13:97888794-97888816 ATTTTCTTGTGGGCAAATTATGG + Intergenic
1113615763 13:111679688-111679710 TTTTTTTTTTGGACAATTAAGGG + Intergenic
1113621231 13:111764590-111764612 TTTTTTTTTTGGACAATTAAGGG + Intergenic
1114158721 14:20137620-20137642 GTTTTGTTTTATGCAATTAAGGG - Intergenic
1114415851 14:22543506-22543528 TTTTTGTTCTAGGGAATTATTGG + Intergenic
1117609478 14:57467547-57467569 AATTTGTTCAGGGCAATGTACGG - Intergenic
1120127258 14:80759847-80759869 AGTTTGTTATGGGCAATTGCAGG - Intronic
1125560122 15:40624253-40624275 ATTTTGCACTGGGCAATAATTGG - Exonic
1126658098 15:51002490-51002512 GTTTTGTTTTAGGCAATGAAGGG + Exonic
1128190309 15:65687365-65687387 TTTTTGTTTTGGACAATTATAGG + Intronic
1128634087 15:69291820-69291842 ATTTTATTATGGGCAAGGAAAGG - Intergenic
1131086289 15:89578148-89578170 ATTTTGTTCTAATTAATTAATGG + Intronic
1131211490 15:90501172-90501194 TTTTTGTTTTAGACAATTAAAGG - Exonic
1131577593 15:93607162-93607184 ATCTTGCTCTGGGTAATTTATGG - Intergenic
1131948592 15:97655011-97655033 ATTTTCTTCTTGGCACTTAATGG - Intergenic
1132763479 16:1522818-1522840 ATTTTTTACTGGGCTACTAAGGG - Intronic
1133847625 16:9470179-9470201 CTTTTGTTCTTGACAATGAATGG - Intergenic
1134138614 16:11697348-11697370 AATTGGTTTTGGCCAATTAAGGG + Intronic
1135782960 16:25322364-25322386 ATATTGTTCTGAGCTATTAAAGG + Intergenic
1137827252 16:51509626-51509648 ATTTTGTTATGGCAACTTAAGGG + Intergenic
1138947170 16:61865263-61865285 ATTTTATTCTGGAGAATTTAGGG + Intronic
1140085062 16:71788013-71788035 ATTTTTCTTTGGGAAATTAATGG + Intronic
1140653550 16:77115394-77115416 ATTTATTTCTGGGCAATTTTAGG + Intergenic
1145876363 17:28321126-28321148 CCTTTCTTCAGGGCAATTAATGG - Intronic
1147856076 17:43481113-43481135 ATTATTTACTGGGCTATTAAAGG + Intergenic
1149371448 17:55996961-55996983 AGTTTGTTCTGGGAAGTTAGAGG - Intergenic
1149532647 17:57407789-57407811 GCTTTGTTCTGGGCTATTAGAGG - Intronic
1158247740 18:55451214-55451236 ATTTTCGTCTGGGTAATGAATGG - Intronic
1158838058 18:61352792-61352814 ATTTTGTGTTGGGCAGTTACAGG - Intronic
1159331796 18:67003970-67003992 ATTCTGTTCTGTGCAATATATGG - Intergenic
927095196 2:19742895-19742917 ATTCTGTTCAGGAAAATTAATGG - Intergenic
927570497 2:24155129-24155151 ATTTTATAGTGAGCAATTAATGG + Intronic
928688810 2:33777520-33777542 ATTTTGGTGTGGGCACTTTAGGG + Intergenic
930737373 2:54793481-54793503 AATTTTTTCTGTGCAATTCAAGG + Intronic
931693329 2:64853556-64853578 GTTCTGTTCTGGGCAAACAAAGG - Intergenic
933862012 2:86479161-86479183 ATTGTGTGATGGGCAACTAAAGG - Intronic
934951514 2:98578938-98578960 TTTTTGTTCTGTGTAATTCAGGG - Intronic
935214335 2:100964228-100964250 ATTTTGTTATATGTAATTAATGG + Intronic
936686287 2:114830175-114830197 ATTATCTTCTGGGCAATAACGGG - Intronic
936854993 2:116946951-116946973 ATTTCTTTCTGGACAATGAAAGG + Intergenic
942126875 2:172835278-172835300 ATTGTGTTCAGATCAATTAAAGG + Intronic
943828138 2:192422434-192422456 TTTTTGTTCCAGGGAATTAATGG + Intergenic
945043565 2:205762903-205762925 TATGTGTTCTGGGAAATTAAGGG - Intronic
947824699 2:233097739-233097761 ATCTTGTTTTGTGCAAATAATGG + Intronic
1169002002 20:2174623-2174645 ATTTCTTCCTGGGCAATTGAAGG + Intronic
1172179835 20:32996088-32996110 ATCTTGCTCTTGGCAATTATGGG - Intronic
1172304926 20:33873953-33873975 ATTTTATTCCGAGGAATTAATGG - Intergenic
1173460804 20:43241998-43242020 AATTCATTCTGGGCATTTAAAGG - Intergenic
1173722780 20:45273942-45273964 ATTTTATTCTGGGAAATCATTGG - Intergenic
1174002977 20:47388296-47388318 GTTCTGTTCTGGACAATTGATGG - Intergenic
1178066707 21:28912392-28912414 ATTTAGTTCAGGGGAAATAAGGG - Intergenic
1179337645 21:40473056-40473078 ATGTTGTTCTGGGGGAATAAAGG + Intronic
1183326107 22:37195345-37195367 ATTTTATTCTGGGTAATGTATGG - Intronic
1184318200 22:43715496-43715518 CTTTTCTTCTGGGAAATTCAAGG + Intronic
949561380 3:5205820-5205842 ATTTTGATCTGGGTGACTAATGG - Intronic
949936253 3:9118600-9118622 ATGTTTTTCTGGGGAATAAATGG - Intronic
952117926 3:30205089-30205111 ATTTAGTACTGGGAATTTAAAGG - Intergenic
952124456 3:30283550-30283572 ATTTTGTTCTGATCATCTAAGGG + Intergenic
952127591 3:30320041-30320063 ATTTTGTTCTTGGCACTCATGGG + Intergenic
952175679 3:30859974-30859996 CTTTTTTTCTGGGCAAAAAATGG + Intronic
952555688 3:34527700-34527722 AATTTGTTCTGAGTAATTACTGG - Intergenic
955651563 3:61199861-61199883 AATTCATTCTGGGCAATTATAGG - Intronic
956582841 3:70833341-70833363 CTATTGTTCTGGGCAATTTAAGG + Intergenic
958509872 3:95034335-95034357 TTTTTGATATAGGCAATTAATGG + Intergenic
961990252 3:131182020-131182042 ATTTTGTTTTGTGACATTAAGGG + Intronic
962842303 3:139246409-139246431 ATTTTCTTCTGGGCAATACATGG + Intronic
963316819 3:143767978-143768000 ATTTTGGACAAGGCAATTAAAGG + Intronic
963650054 3:147968129-147968151 ATTTTGTGCTGGGGAATTGTAGG + Intergenic
964814036 3:160697510-160697532 ATTATGATCTAAGCAATTAAAGG - Intergenic
965318040 3:167215006-167215028 TTTTTGATGTGGGCATTTAATGG - Intergenic
965766393 3:172135109-172135131 ATTATGTACTAGCCAATTAATGG - Intronic
966749929 3:183312512-183312534 ATTTTGTGCTTGGGAATTATGGG + Intronic
967654958 3:192036244-192036266 ATTTTGATCTGTACAGTTAATGG - Intergenic
969907747 4:10412977-10412999 ATTTTCTTCTTGGCAGTAAATGG - Intergenic
970695663 4:18673959-18673981 ATTTTGTCCTGTACAAGTAAGGG + Intergenic
970766654 4:19557518-19557540 ATTTTGTGCTGCTAAATTAATGG - Intergenic
971052444 4:22876437-22876459 ATTTTTTTGTGTGCAATTGAAGG - Intergenic
972450837 4:39196748-39196770 AATTTGTTCTGGCCATTTTAAGG - Intronic
972875331 4:43351924-43351946 ATTTCTTTGTGGGCAATTAATGG - Intergenic
972992306 4:44835549-44835571 ATTTTTTTCAGGACACTTAATGG - Intergenic
973946344 4:55960437-55960459 ATTTTGATTTGGGTAATTATAGG + Intronic
977505328 4:97895435-97895457 ATTTTGTATTGGCTAATTAATGG - Intronic
977616896 4:99097055-99097077 TTTCTGTTCTGGGCATTTACTGG + Intergenic
979001754 4:115229994-115230016 AAATTTTTCTGGGCAAGTAAGGG + Intergenic
981104306 4:140863282-140863304 AATGTTTTCTGGGCAAATAATGG - Exonic
982569928 4:157035928-157035950 ATTTTGATATGGGGAATAAAAGG + Intergenic
983106057 4:163687530-163687552 ATTTTTTTCTGGTAGATTAAAGG + Intronic
983211076 4:164958312-164958334 GATTTGTTCTGGACAATGAAGGG + Exonic
984664229 4:182408378-182408400 ATCATGTTCTGGGCAGTTAGGGG + Intronic
985091617 4:186368643-186368665 ATTTTATTATGGGCAATGCAAGG - Intergenic
989089816 5:37718503-37718525 ATATTGTCCTGGGCCATTTATGG + Intronic
989967043 5:50476514-50476536 TTTTTATTCTGGACAATTAATGG + Intergenic
990008805 5:50970832-50970854 ATTTTAATCAGGGCAATAAAAGG - Intergenic
992076609 5:73198168-73198190 ATTTTGTTTCGGGGAACTAAAGG - Intergenic
993289526 5:86047131-86047153 ATTTTGTTGTGGGCAAGAAGGGG - Intergenic
994141985 5:96351935-96351957 ATTTTGGTCTCTGCAATTAAAGG - Intergenic
995797294 5:115955589-115955611 ATTTTGTCCTGGACAACTCAGGG + Intergenic
996104654 5:119485618-119485640 ATTTCCTTATGGGCAATTAAAGG + Intronic
1000069934 5:157731147-157731169 ATTTTGATCTGGGCACTAACGGG + Intergenic
1001442443 5:171754401-171754423 TTTTTATTCTGGGACATTAATGG + Intergenic
1002519630 5:179784455-179784477 ATTTTTTTCAGGGCAAATGATGG + Intronic
1003098764 6:3161283-3161305 ATTTTGTTCAAAGCATTTAAGGG + Intergenic
1003278264 6:4670781-4670803 GTTTGGTTATGGGCTATTAAGGG + Intergenic
1003433235 6:6059841-6059863 ATTTTGTTAGGTGCAAATAATGG - Intergenic
1003523540 6:6879563-6879585 TTTGTGTTCTGGGACATTAATGG + Intergenic
1003854180 6:10255270-10255292 ATTTTCTTCTGGGCCTTTATTGG + Intergenic
1004429718 6:15532607-15532629 ATTCTGTACTGGAGAATTAAGGG + Intronic
1005040992 6:21600478-21600500 TTTTTTTTCTTGGCACTTAAAGG - Intergenic
1005104780 6:22212913-22212935 ATTTTGTTATTGTAAATTAATGG - Intergenic
1005417567 6:25617683-25617705 CTTTTGTTCTTAGTAATTAAAGG + Intronic
1006246391 6:32740783-32740805 TTTTTGACCAGGGCAATTAAAGG - Intergenic
1008009610 6:46452095-46452117 ATTTGGTTCTGGGGATTCAATGG - Intronic
1008586273 6:52953032-52953054 ATTTAGTGCTTGGCAATGAAAGG - Intergenic
1009674444 6:66799335-66799357 ATTTTGTATTGGTAAATTAATGG + Intergenic
1010862821 6:80934878-80934900 ATTTTGATATAGGCATTTAAGGG + Intergenic
1013790625 6:113832465-113832487 ATTCTGTTCTGGGCTGCTAAGGG + Intergenic
1015505837 6:133986761-133986783 ATTTTGTTCTGGGCAATTAAAGG - Intronic
1016320044 6:142832588-142832610 ATTTTTCTCTTGGCAATTCATGG + Intronic
1023842737 7:44106202-44106224 ATTCTGTTCTGGGCACAGAAGGG - Intronic
1024442372 7:49435458-49435480 ATAATGTTCTGGGAAATTATGGG - Intergenic
1027635411 7:80666596-80666618 ATTTTGTTGTGGGGATATAAAGG - Intronic
1030393517 7:108956709-108956731 ATTTCTTCCTGGACAATTAATGG - Intergenic
1030648698 7:112093316-112093338 AATTCTTTCTGGGCAATTAACGG + Intronic
1030724121 7:112905035-112905057 ATTTAGTAGTGGGGAATTAATGG - Intronic
1031159809 7:118152841-118152863 ATTTTGGTCTTGGCAAATAAGGG - Intergenic
1031192903 7:118577400-118577422 ATATAGTTCTGGACAATTAGAGG + Intergenic
1032402318 7:131632171-131632193 AATTTTTTCTGTGCCATTAAGGG + Intergenic
1032789683 7:135233229-135233251 ATTTTAATCTGAGCTATTAAAGG + Intronic
1033913221 7:146289891-146289913 ATTTTGTGTTTGGCAATAAACGG + Intronic
1034301968 7:150024197-150024219 TCTTTCTTTTGGGCAATTAAGGG + Intergenic
1034804079 7:154073118-154073140 TCTTTCTTTTGGGCAATTAAGGG - Intronic
1034938666 7:155215992-155216014 AGTTTGTTCTGGGCAGATGAGGG - Intergenic
1035105397 7:156437768-156437790 ATTATGATCTGGGCAATGGATGG + Intergenic
1035382198 7:158447312-158447334 ATTTAGCTCAAGGCAATTAATGG - Intronic
1037066674 8:14588183-14588205 TTTTTCTTCTGGGTAATCAATGG - Intronic
1037692744 8:21196038-21196060 CTTTAGTTCCTGGCAATTAATGG - Intergenic
1038172684 8:25152004-25152026 CTTTTTTTCTGAGCCATTAAGGG - Intergenic
1038861196 8:31390748-31390770 ATTGTGTTCTGGTCAGCTAAGGG - Intergenic
1040896737 8:52375898-52375920 CTTTTGATTTGAGCAATTAACGG - Intronic
1041603566 8:59752439-59752461 ATTTTTTTCCAGGAAATTAATGG - Intergenic
1042809554 8:72809189-72809211 ACTTAGATCTGGGCATTTAAAGG - Intronic
1043186128 8:77152211-77152233 TTTTTATTGTGGGAAATTAAGGG - Intergenic
1043192921 8:77249733-77249755 ATTTTTTTCTAGACATTTAATGG + Intergenic
1043369058 8:79569889-79569911 AGTTGGTTCTGAGAAATTAATGG - Intergenic
1044653677 8:94525022-94525044 ATTGTGTACTGGGAAATCAATGG - Intronic
1044775435 8:95682127-95682149 GTTTTCCTCTGGGAAATTAAGGG - Intergenic
1046960682 8:120110011-120110033 ATTTTGTTCTGTGTAAGTGAGGG - Intronic
1048724152 8:137362562-137362584 ATTTTTTTCTAGGGATTTAAAGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1048834251 8:138503172-138503194 ATTTTGTTCATTGCAATTTAGGG - Intergenic
1052674447 9:31601673-31601695 ATTTTATTCTGGGAAGATAAAGG - Intergenic
1052977772 9:34424314-34424336 ATTTTGTTCTAAGAAATTATGGG + Intronic
1054994056 9:71364406-71364428 ATTTTACTCTGGCCAATTAGTGG - Intronic
1058017632 9:100053716-100053738 ACTATGTTCTAGGTAATTAAAGG + Intronic
1058476909 9:105344492-105344514 ATTTTGTGCTGGACAATTCTTGG - Intronic
1058724853 9:107792752-107792774 ATTTTGTTCTGTTCAATTCAGGG + Intergenic
1060169758 9:121451962-121451984 ATTTTGTTCTCAGCATTTTAGGG + Intergenic
1187752879 X:22486942-22486964 TTTTTTTTAAGGGCAATTAATGG + Intergenic
1188684000 X:33046569-33046591 ATGTTATCCTGGGCAATCAATGG - Intronic
1190982502 X:55468432-55468454 ATTCTGTTCATGGCAATTAGAGG - Intergenic
1190986197 X:55504751-55504773 ATTCTGTTCATGGCAATTAGAGG + Intergenic
1191045832 X:56135883-56135905 ATTTTGATGTGGGCATTTAGTGG - Intergenic
1193314696 X:80050644-80050666 ATTTTCTTCTAGGGTATTAATGG + Intergenic
1194847153 X:98824550-98824572 AAGTTCTTCTGGGCAGTTAAAGG + Intergenic
1195371825 X:104183319-104183341 ATTTTCTTTTTTGCAATTAAAGG + Intronic
1196670528 X:118361890-118361912 GTTTTTCTCTGGGCAATTATTGG - Intronic
1197428374 X:126326442-126326464 ATTTTGTTCTGGGCTTTTTTTGG - Intergenic
1198410287 X:136360315-136360337 ATTTTTTTCTGAGCACTTACTGG - Intronic
1198608118 X:138367014-138367036 ATTTTGTTCAAAGAAATTAAAGG - Intergenic
1201784653 Y:17761335-17761357 ATTTTCTTATTGGCTATTAATGG + Intergenic
1201816900 Y:18144652-18144674 ATTTTCTTATTGGCTATTAATGG - Intergenic