ID: 1015506777

View in Genome Browser
Species Human (GRCh38)
Location 6:133996719-133996741
Sequence GTGAACTTGAAGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 359}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015506777_1015506782 9 Left 1015506777 6:133996719-133996741 CCTTCCTCATTCTTCAAGTTCAC 0: 1
1: 0
2: 2
3: 24
4: 359
Right 1015506782 6:133996751-133996773 TGTGCACAAGCAGGTTCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 118
1015506777_1015506780 0 Left 1015506777 6:133996719-133996741 CCTTCCTCATTCTTCAAGTTCAC 0: 1
1: 0
2: 2
3: 24
4: 359
Right 1015506780 6:133996742-133996764 CTCAGCTTCTGTGCACAAGCAGG No data
1015506777_1015506781 8 Left 1015506777 6:133996719-133996741 CCTTCCTCATTCTTCAAGTTCAC 0: 1
1: 0
2: 2
3: 24
4: 359
Right 1015506781 6:133996750-133996772 CTGTGCACAAGCAGGTTCCATGG 0: 1
1: 0
2: 1
3: 14
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015506777 Original CRISPR GTGAACTTGAAGAATGAGGA AGG (reversed) Intronic
900034601 1:396511-396533 GTGAACCTGCAGGATTAGGAGGG - Intergenic
900055432 1:626399-626421 GTGAACCTGCAGGATTAGGAGGG - Intergenic
900307498 1:2018414-2018436 GGGAAGTGGAAGAATGAGGCTGG - Intergenic
900733130 1:4276078-4276100 GTGAAATTGCAGAAGGAGGTGGG + Intergenic
901499751 1:9644576-9644598 AGGAACTTGAAGAACGATGATGG - Intergenic
902075608 1:13782434-13782456 TTGGACCTGAAGGATGAGGAGGG - Exonic
902225456 1:14993869-14993891 CTGGGCTTGAAGGATGAGGAGGG + Intronic
902808417 1:18874900-18874922 GTGAGCTTGGAGAGGGAGGAAGG - Intronic
904218139 1:28941074-28941096 GTGAAGTTAAATAATGAAGAAGG + Intronic
905316561 1:37085280-37085302 GGCAACTCGAAGAATGGGGAAGG - Intergenic
906559816 1:46748261-46748283 ATGAACTTGGAGAAGTAGGATGG - Intergenic
907327433 1:53648815-53648837 GTTACCTTGAAGAAGGAGGCAGG + Intronic
908379146 1:63578156-63578178 GTGACCTTGAAGAGATAGGAGGG + Intronic
908511600 1:64854127-64854149 CTGAACTTGGTGAAAGAGGAGGG - Intronic
908625665 1:66038490-66038512 TTGAACTTTAAGAATGCCGAGGG - Intronic
908719385 1:67108090-67108112 GTGATATTTAAGAATGAAGATGG - Intronic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
909044534 1:70692991-70693013 ATGAAATTGAAGAAAGAGGCAGG + Intergenic
909270299 1:73615584-73615606 CTGAACTTGTAGAATGAGTTTGG + Intergenic
910813966 1:91269512-91269534 GTACAGTTGAAGAATAAGGAAGG - Intronic
910814895 1:91281334-91281356 GTGAACTTAAAGAAACAAGATGG - Intronic
912073701 1:105845979-105846001 GTTAACTGGAAGAAGAAGGAAGG + Intergenic
913423376 1:118698550-118698572 GACAACTTGAAGCAAGAGGAAGG + Intergenic
914096759 1:144550897-144550919 GGGGTCTTGAAGAAAGAGGAAGG + Intergenic
915281730 1:154827393-154827415 GTGAGATTGAGGAATGAGGAAGG - Intronic
915824360 1:159058792-159058814 GACAACATGAAGCATGAGGAGGG + Intergenic
915900895 1:159846035-159846057 GAGAAAGTGAGGAATGAGGATGG - Intronic
916819185 1:168381564-168381586 CTGAAGTTGAAGAAGGATGAAGG + Intergenic
916915028 1:169397189-169397211 ATGAACATGAGGAAGGAGGAGGG + Intronic
917996347 1:180442698-180442720 GTGAACTTGAAGCTCGAAGATGG - Intronic
918355017 1:183699816-183699838 TTGGGCTTGAAGAATGAGGAAGG - Intronic
918427235 1:184423232-184423254 GTGAAGTTCCTGAATGAGGAAGG - Intronic
918548693 1:185714799-185714821 GAGGACTTGAAGCATGAGGCTGG + Intergenic
920761173 1:208784940-208784962 CTTAAATGGAAGAATGAGGATGG - Intergenic
921062365 1:211596422-211596444 GAGAACTTGAAGCAAGAGGTTGG + Intergenic
921725955 1:218523599-218523621 GAGAACATGAAGTGTGAGGAAGG + Intergenic
922017105 1:221659899-221659921 GTGAAATGGAAGCAAGAGGAAGG - Intergenic
922044670 1:221932995-221933017 CTGAACTTGTAGAATGAGTTTGG - Intergenic
922145420 1:222939415-222939437 GAAAACATGAAGATTGAGGAGGG + Intronic
922256958 1:223900716-223900738 GTGAACCTGCAGGATTAGGAGGG - Intergenic
922601794 1:226861594-226861616 CTGGCCTTGAAGATTGAGGATGG - Intergenic
923155792 1:231278363-231278385 GTGAAATTGAAGACAGAGGCAGG + Intergenic
924107899 1:240667700-240667722 GTGAAGACGAAGAATGAAGAGGG - Intergenic
924338152 1:243003529-243003551 GTGAACCTGCAGGATTAGGAGGG - Intergenic
1063266170 10:4453565-4453587 GGAAACTGGAAGAATGAGTAGGG - Intergenic
1063497162 10:6520590-6520612 AGGAACTTGAAAGATGAGGAAGG - Intronic
1063585820 10:7351333-7351355 CTTAACCAGAAGAATGAGGATGG + Intronic
1064151708 10:12871118-12871140 TTGAACTTGGAAAATGAGGAAGG + Intergenic
1065044930 10:21738659-21738681 GTTAAGATGAAGAATGAGAAGGG - Intronic
1065963405 10:30752416-30752438 ATGAAATTGTAGACTGAGGAAGG + Intergenic
1069194298 10:65529418-65529440 ATGAACTTTTAAAATGAGGAGGG - Intergenic
1071929317 10:90449534-90449556 GTAAACTTGAAGATAGATGAGGG - Intergenic
1072014577 10:91334320-91334342 GTGAACATAAAGAATGAGGTGGG + Intergenic
1072825905 10:98605984-98606006 GCTAAGTTGAATAATGAGGAGGG - Intronic
1074100435 10:110350280-110350302 ATGGACTTGAAGAAGGAGCAAGG - Intergenic
1074435723 10:113432530-113432552 GAGAGCTGGAAGGATGAGGAAGG + Intergenic
1075204837 10:120437853-120437875 CTGAACATGATGAAAGAGGAAGG - Intergenic
1078065701 11:8077913-8077935 GTGACCTTGCAGTCTGAGGAAGG - Intronic
1079941460 11:26685717-26685739 GGCAACATGAAGAATGGGGATGG + Intronic
1082079845 11:48004304-48004326 GTGAAGTTGAAGAAAGGGTAGGG - Intronic
1085152189 11:74261117-74261139 GACAATTTGAAGAGTGAGGATGG + Intronic
1085417793 11:76330772-76330794 CTGGACCTGAAGAATGAAGAGGG - Intergenic
1085999637 11:81966442-81966464 CTGAACTTGAAGATGGAAGAAGG + Intergenic
1086067216 11:82758500-82758522 GTGACCCTGAACAATGAGGGTGG - Intergenic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1086671068 11:89548551-89548573 AGAAACTTGGAGAATGAGGAAGG + Intergenic
1087806738 11:102563539-102563561 GTGCACTTGCATCATGAGGATGG - Intergenic
1089949566 11:122512672-122512694 GTGACTTTGAAGATGGAGGAAGG - Intergenic
1090229728 11:125092867-125092889 CTGACCTTGAAGACTGAGGAAGG + Intergenic
1092282225 12:7106906-7106928 GTAAACTGGCAGAATGAGGAGGG + Intronic
1092322990 12:7498429-7498451 GTGAACTTGAAAAATGATTTGGG + Intronic
1092380820 12:7995633-7995655 GCTAACTTGAAGGATCAGGAAGG - Intergenic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1093380245 12:18482640-18482662 GTGAACATGAAGAAAAAGCAAGG - Intronic
1095646319 12:44552269-44552291 GTAATATTGAAGAATGAAGAGGG - Intronic
1096569850 12:52515904-52515926 ATGAACTCGAATCATGAGGATGG - Intronic
1097129895 12:56804283-56804305 GTGACCAGGAAGAATGAGGTAGG + Intergenic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1098429559 12:70404922-70404944 GTGAACATTTAGAGTGAGGAGGG + Intronic
1099150660 12:79109002-79109024 GACAATTTGAAGCATGAGGAGGG + Intronic
1099426977 12:82535415-82535437 GTGGTCCTGCAGAATGAGGATGG - Intergenic
1099931119 12:89076163-89076185 ATGAAATTGAAGCATGAGAATGG + Intergenic
1100154779 12:91785023-91785045 GTGAACTTGAAGAAAAAAAATGG - Intergenic
1101055565 12:100909104-100909126 TTAAATTTGAAGAATGTGGATGG + Intronic
1101221626 12:102647240-102647262 GAGAGGTTCAAGAATGAGGAGGG + Intergenic
1101699019 12:107154181-107154203 TTGAATGTGGAGAATGAGGATGG - Intergenic
1102560138 12:113756076-113756098 CTGACCTTGAAGAAGGAAGAAGG + Intergenic
1102648589 12:114420041-114420063 GAGAATTTGAGGAATCAGGAGGG + Intergenic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1107232065 13:38121705-38121727 GGGAAGTTGAAGAATGAGTGGGG - Intergenic
1107323621 13:39216008-39216030 CTGGCTTTGAAGAATGAGGAAGG - Intergenic
1107571895 13:41670291-41670313 ACTAATTTGAAGAATGAGGAAGG - Intronic
1108275157 13:48800831-48800853 TGGAACATGAAGAATGAAGAGGG + Intergenic
1110533451 13:76623597-76623619 GAGAAAGAGAAGAATGAGGAGGG - Intergenic
1110947876 13:81446200-81446222 GAGAACTTGAAGAATAAGACGGG - Intergenic
1111899645 13:94185129-94185151 GTGAACTAGCAGAGTGGGGAAGG + Intronic
1113074310 13:106452979-106453001 GTGGTCTTGAAGAATTAAGAAGG + Intergenic
1113394009 13:109927306-109927328 GATATCTTGAAGAATGAGCATGG - Intergenic
1114380914 14:22202570-22202592 GTGCACTTGAACAATGAAGTTGG + Intergenic
1114768197 14:25398630-25398652 GTGAACTTTCAGAATGAGCCAGG - Intergenic
1115107056 14:29774219-29774241 ATGCACTTGAAGAGGGAGGATGG + Intronic
1115170816 14:30504228-30504250 GAGACCTTGAAGCATGAGAATGG + Intergenic
1116355593 14:43924781-43924803 GACAATTTGAAGAGTGAGGAGGG - Intergenic
1116676654 14:47914750-47914772 GTAATCTTGGAGAATCAGGAGGG + Intergenic
1117235051 14:53764777-53764799 GTGAACTAGATGACTGTGGAAGG + Intergenic
1118043006 14:61937758-61937780 GAGAACTAGAGGAAAGAGGAAGG + Intergenic
1118297909 14:64587318-64587340 GTGAAGATGAGGAATCAGGAGGG + Exonic
1118910133 14:70055192-70055214 GTGAACAAGATGAATTAGGATGG - Intronic
1118952511 14:70447192-70447214 GACAAATTGAAGGATGAGGAGGG + Intergenic
1120508397 14:85381655-85381677 GTAAACTTCAGGAATGATGAGGG - Intergenic
1121926837 14:97934712-97934734 CTGACTTTGAAGAAAGAGGAAGG + Intronic
1124091983 15:26614012-26614034 GTGTACTGGAAGCATGATGAGGG + Intronic
1124858093 15:33410469-33410491 CTGAGTTTGAATAATGAGGATGG - Intronic
1126225766 15:46267276-46267298 GGGACGTTGAAGGATGAGGAAGG - Intergenic
1126663965 15:51058745-51058767 GTGAGCTAGTAGAATCAGGAAGG - Intronic
1126883508 15:53124589-53124611 TTGAACTGGAAAAATAAGGAGGG + Intergenic
1127318872 15:57823329-57823351 GTTACCTGGAAGAATGAGTAAGG + Intergenic
1127707459 15:61561447-61561469 TTGAAATTGAAGAGAGAGGAGGG - Intergenic
1128127715 15:65205225-65205247 GTGAGGCTGAAGAATGAGGAGGG - Intronic
1128407866 15:67362061-67362083 GGGAACAGGAAGAAAGAGGAAGG + Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1128711155 15:69872886-69872908 GTCAGCTTGAAGGATGAGCATGG - Intergenic
1132853996 16:2036728-2036750 GTGAACGGGCAGAATGTGGAGGG + Exonic
1133180368 16:4049664-4049686 GTGGACATGAAGGATGCGGAAGG - Intronic
1133343045 16:5050623-5050645 CTGAACTTGTAGAATGAGTTGGG - Intronic
1134504015 16:14790854-14790876 GGGCTCTTGAGGAATGAGGAAGG + Intronic
1134576557 16:15338054-15338076 GGGCTCTTGAGGAATGAGGAAGG - Intergenic
1135110388 16:19686524-19686546 GTGACGTGGAAGAGTGAGGAGGG - Intronic
1135264509 16:21011233-21011255 TTGATTTTGAAGGATGAGGAAGG + Intronic
1136318713 16:29468721-29468743 GTGAAGACAAAGAATGAGGAGGG + Intergenic
1136433285 16:30208065-30208087 GTGAAGACAAAGAATGAGGAGGG + Intronic
1136487263 16:30581651-30581673 GTGCACTTGCAGAATGAGAGTGG + Exonic
1138992672 16:62410157-62410179 GTGACCAAGAAGAATGAGGTAGG + Intergenic
1141449306 16:84086706-84086728 CTGACCCTGAAGAATGAGAAGGG + Intronic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143714162 17:8755167-8755189 GGGAACCTGGAGAAGGAGGATGG + Intronic
1144497744 17:15759272-15759294 GTGTATTTGAAGAAAGAGGGTGG - Intergenic
1144629542 17:16863760-16863782 GTGTATTTGAAGAAAGAGGGTGG - Intergenic
1145240856 17:21240505-21240527 ATGAGCTTGGAGAATGAGGAAGG + Exonic
1146522170 17:33534205-33534227 TTGAATTTGAAGAATGATGCTGG - Intronic
1146551625 17:33785205-33785227 GTGAAGATGAAGAAAGAAGATGG + Intronic
1149686995 17:58541488-58541510 GTAAACTTGGGGCATGAGGAGGG + Intergenic
1150227091 17:63530120-63530142 GTGCCCGTGAAGAACGAGGACGG + Exonic
1150977233 17:70102184-70102206 GTGAACAAGAAGAAAGAAGAAGG - Intronic
1151507777 17:74540817-74540839 GTCCCCTTGAAGAAGGAGGAAGG + Intergenic
1151719026 17:75845227-75845249 GTGAACTTGAAGGGACAGGAGGG - Intergenic
1152252374 17:79218745-79218767 CTGGCCTTGAAGAATGAGGAGGG + Intronic
1155252482 18:23965654-23965676 GTGACCTTGAAGAAAGGTGAGGG + Intergenic
1156989679 18:43393905-43393927 ATGAACTTGAAGAAACAAGAAGG + Intergenic
1157182752 18:45511971-45511993 TTGACCCTGAAGAAAGAGGAAGG + Intronic
1158296000 18:55997510-55997532 GTGAACTTGAAGAGGGAGGAGGG - Intergenic
1158858764 18:61571386-61571408 GTGAACTCTAACAGTGAGGATGG - Intergenic
1159249314 18:65853259-65853281 CTGAACTAGAAGTGTGAGGATGG - Intronic
1159254028 18:65922077-65922099 GTGAACTACCAGAAGGAGGAGGG - Intergenic
1159734830 18:72082616-72082638 GTCATCTAGAAGAAAGAGGAGGG + Intergenic
1159949095 18:74466788-74466810 GTGGTCTTGAAGGATGAGCAGGG - Intergenic
1160128848 18:76205819-76205841 GTGAACTTGAGGATTGTTGAGGG + Intergenic
1163082516 19:14954173-14954195 GTTAACTTGAGCAATGAAGATGG + Exonic
1164912513 19:32024628-32024650 GTGAACTTGAAGAAGCAAGGAGG - Intergenic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1167442387 19:49515903-49515925 CTGACCTTGAAGAATAAGGAGGG - Intronic
1168200435 19:54811291-54811313 GGGAAGTTGAAGAAGGAGAATGG + Intronic
925468808 2:4136412-4136434 GTGAACTGGGAGAGCGAGGATGG + Intergenic
925524315 2:4782927-4782949 CTGACCTTGAAGAATGAACATGG + Intergenic
925639666 2:5975236-5975258 GTGAATTTGTGTAATGAGGATGG + Intergenic
928301944 2:30132976-30132998 GTGGACTAGGAGAATGAGCATGG + Intergenic
929015303 2:37487704-37487726 ATGAACTTGAAAAATGGAGAGGG - Intergenic
929957457 2:46469599-46469621 GTGAAGTGGAAGGATGGGGAGGG - Intronic
930505599 2:52279746-52279768 GAGAACTTGATGAAAAAGGAAGG + Intergenic
933309042 2:80637748-80637770 GAGAAGTGAAAGAATGAGGAAGG + Intronic
934604865 2:95687014-95687036 GTGGACTTAGAGGATGAGGAGGG - Intergenic
935384882 2:102489487-102489509 CTGAACTTGAAGAAAGATGGAGG - Intronic
937260914 2:120586453-120586475 GGAAACCTGAAGGATGAGGAGGG - Intergenic
939642830 2:144661190-144661212 GTGAAGTTGAAAAATGAGGAAGG + Intergenic
939905848 2:147913622-147913644 GATCACTTGAAGAATGAGGGAGG + Intronic
941063817 2:160878370-160878392 CTGAGCTTGAAGATGGAGGAAGG - Intergenic
941087883 2:161139275-161139297 GTTAACATTAAGAATGAGGTTGG + Intronic
943298617 2:186169403-186169425 GAGCATTTGAAGAATGAGGCGGG + Intergenic
943490298 2:188545270-188545292 GGGAACTTGGAGTATAAGGAAGG + Intronic
944461086 2:199951536-199951558 ATGAAATGGAAGAATGTGGATGG - Intronic
944865731 2:203859639-203859661 CTGAACTGGAAGTATGAAGAGGG + Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948041238 2:234903297-234903319 GTGAACATGAAGGCTGAGGTTGG + Intergenic
948123195 2:235545984-235546006 TGAATCTTGAAGAATGAGGAGGG - Intronic
948883582 2:240872283-240872305 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883588 2:240872315-240872337 GTGAACATGGAGGAGGAGGAGGG + Intronic
948883607 2:240872440-240872462 GTGAACATGCAGGAGGAGGAGGG + Intronic
1169868920 20:10230851-10230873 GTGAGTTTGAAGGATGAGGAAGG + Intronic
1170379133 20:15737149-15737171 GTTAACTGGGAAAATGAGGAAGG + Intronic
1171293726 20:23998384-23998406 GTGAACTTGCAGAATAAGGCAGG + Intergenic
1171326734 20:24300910-24300932 CTGAGCTGGAAGAAGGAGGAGGG + Intergenic
1172356155 20:34281412-34281434 CTTGAGTTGAAGAATGAGGAAGG - Intronic
1172507679 20:35475708-35475730 TTGAAGGTGAAGAATGAGGCAGG - Intronic
1173351964 20:42253533-42253555 GGGAACTGGGAGAAGGAGGAGGG + Intronic
1174970857 20:55274114-55274136 GAGAGCTGGAAGAATGAGGGAGG - Intergenic
1175019929 20:55835075-55835097 CTGATTTTGAAGATTGAGGAGGG - Intergenic
1175061252 20:56245482-56245504 TGGATCTTGAAGAATAAGGAGGG + Intergenic
1175159471 20:56997134-56997156 ATGAAGCTGAAGAAAGAGGAAGG + Intergenic
1175626601 20:60493398-60493420 ATTAACTTCAAGAAGGAGGATGG + Intergenic
1177586094 21:23097765-23097787 GGGAACTTGCACAAGGAGGAGGG - Intergenic
1178370093 21:32020341-32020363 GTGAACTTGAAGGAGCAGGGAGG + Intronic
1178799609 21:35780301-35780323 GGGAACTTTGAGAATGATGAGGG - Intronic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1181453959 22:23044561-23044583 GACAATTTGAAGGATGAGGATGG + Intergenic
1182097567 22:27636450-27636472 GAGAACTTGAAAAATGTGGCAGG + Intergenic
1183065159 22:35357579-35357601 GAGAACCTGAAGAATGTGGCAGG - Intergenic
1183108260 22:35630004-35630026 TTGAACTTGAAGAATGTTGGCGG + Intronic
1183132897 22:35856663-35856685 TTGAGCTGGAAGGATGAGGATGG + Intronic
1184907522 22:47498875-47498897 GTGAAGTGGACCAATGAGGAAGG + Intergenic
949258750 3:2081633-2081655 GGGACATTGAAGAGTGAGGAGGG - Intergenic
949401396 3:3668681-3668703 ATGACTTTGAAGAAGGAGGAAGG - Intergenic
949779145 3:7666210-7666232 TTGAACCTGAAGAATGAGTTAGG + Intronic
949935033 3:9109928-9109950 GTGAACATGGAGACTGAGGCAGG + Intronic
950728741 3:14937494-14937516 GTGAACCTGGAGAATGGGAAGGG - Intergenic
951267996 3:20592190-20592212 TTGACCTTGTAGAATGAGTAGGG + Intergenic
951388713 3:22075353-22075375 GTGAAATTGAAGAATGAATTGGG - Intronic
951514010 3:23537637-23537659 GTGATGTTGGAGAATGAAGAAGG - Intronic
951906550 3:27713061-27713083 GTAAACTTGAGGAATGACGGCGG + Intergenic
953061807 3:39434066-39434088 GTGCACCTGGAGAATGAGCAGGG - Intergenic
955141850 3:56277526-56277548 AAGAACCTAAAGAATGAGGAGGG - Intronic
955165496 3:56507053-56507075 CTGAACTTGTAGAATGAGTTTGG - Intergenic
956959845 3:74386377-74386399 GGGAAGTTGAAGAAGGTGGATGG + Intronic
958746678 3:98144176-98144198 GTGGACTAGTAGATTGAGGAGGG - Intergenic
958998814 3:100938137-100938159 GCCTACTTGAAGAAGGAGGATGG + Intronic
959007842 3:101040526-101040548 GTGTATCTGAGGAATGAGGAGGG - Intergenic
959375598 3:105585016-105585038 CTCAACTTGAAGCATAAGGAAGG - Intergenic
959572473 3:107899725-107899747 GTGAAATTAAAGAAGGAGGCAGG - Intergenic
960092686 3:113657526-113657548 CTGAGTTTGAAGAATTAGGAGGG + Exonic
960286761 3:115838663-115838685 GAGAACTAGATGAATGAGAAAGG + Intronic
961219866 3:125191249-125191271 GTGAATTGGAAAAATGAGCAAGG - Intronic
961851947 3:129829033-129829055 GTGAACTTGATGAATATGAATGG - Intronic
962558342 3:136579097-136579119 GGGATCTTGAAGAATGACTATGG + Intronic
963758760 3:149263502-149263524 GTGACCTTGCAGAATGAGTTAGG - Intergenic
965421129 3:168459869-168459891 CTGGACTTTAAGAATTAGGATGG - Intergenic
965509262 3:169550077-169550099 GGGGATTTGAAGGATGAGGAGGG + Intronic
965697841 3:171427959-171427981 TTGAGCTTGAGGAATGAGGAGGG + Intronic
966339944 3:178914533-178914555 GTGCCCTGGAAGCATGAGGAAGG - Intergenic
967277451 3:187790443-187790465 GAGAACTTGTAGAGTGAGAAAGG - Intergenic
967278779 3:187802423-187802445 GTGAGCTGAAAGAAAGAGGAGGG - Intergenic
969033039 4:4228393-4228415 GTGAATTGGAAGAATGATGGTGG - Intergenic
969135186 4:5023586-5023608 GAGACATTGAAGAATGAGAATGG - Intergenic
969224634 4:5787468-5787490 CTGGACTTGAAGACGGAGGAAGG + Intronic
972234854 4:37120061-37120083 GTGAAAATGGAGAGTGAGGATGG - Intergenic
972471256 4:39406851-39406873 TTGAACTGGGAGACTGAGGATGG - Exonic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973333969 4:48937331-48937353 TAGAAGTTGAGGAATGAGGATGG - Intergenic
973881109 4:55272066-55272088 GGGAATTTGAAGAATGTGAAGGG - Intergenic
973936787 4:55854141-55854163 GTGAATTTGGACAAAGAGGAAGG - Intronic
975045278 4:69795894-69795916 GTTAAATTTAAGAATGATGAAGG + Intergenic
978932571 4:114333407-114333429 GTGAACTCAAAGAAAGAAGAAGG - Intergenic
979238969 4:118431759-118431781 GTGAACCTGCAGGATTAGGAGGG + Intergenic
981276266 4:142901131-142901153 TTGAACCTGAAGAGTCAGGATGG - Intergenic
983094839 4:163549508-163549530 GAGAACTTGAAGACTAAGGAAGG - Intronic
984634373 4:182094548-182094570 TTGAACTTTAAGAATAAGGCTGG - Intergenic
984770982 4:183436186-183436208 GAAAACTTGAAGGGTGAGGAGGG + Intergenic
984939813 4:184921204-184921226 ATAAACTTGAAGAATGAGCCAGG - Intergenic
985277023 4:188246947-188246969 CTAAACTTGAAGAATGATGATGG + Intergenic
985362578 4:189191537-189191559 GTTCACATGAGGAATGAGGATGG + Intergenic
986985820 5:13500139-13500161 GTGCAATTGTATAATGAGGATGG - Intergenic
988205386 5:28126796-28126818 GTGAGCATGAAGACTGAAGACGG - Intergenic
988340357 5:29962281-29962303 GACAATTTGAATAATGAGGAGGG + Intergenic
988522973 5:31962852-31962874 GTGATCTGGAAGAATCTGGAAGG - Intronic
990344473 5:54857875-54857897 TTGAACGTAAAGAATGTGGAAGG + Intergenic
990659921 5:58001938-58001960 GTGAATTTCAAAAAAGAGGAGGG - Intergenic
990836439 5:60026835-60026857 ATGAAATTGAAGAGTGAGCACGG - Intronic
991952640 5:71961464-71961486 GTGAAGTTGAAAAATGAAGTGGG + Intergenic
994892285 5:105651566-105651588 TTGACCTTGAAGAATGAGTTGGG - Intergenic
996165768 5:120220890-120220912 GGGGACTTCAAAAATGAGGATGG - Intergenic
997817433 5:137032843-137032865 ATGGACTTGAAGGCTGAGGATGG + Intronic
998499683 5:142621523-142621545 GTGAATTTTAAGAAAGAGTAGGG - Intronic
999226940 5:150033456-150033478 GTGAACATGAAGTGTGAGTATGG + Intronic
1000259410 5:159572251-159572273 GTGAAGCTGGAGAATGGGGATGG + Intergenic
1000478410 5:161741968-161741990 CTTAGCTTGAAGAATGAGTAAGG + Intergenic
1000650775 5:163815744-163815766 GTCAACTTGAAGAATTTGGTAGG + Intergenic
1002624479 5:180515601-180515623 TTGAAGTTGAGAAATGAGGAGGG + Intronic
1002739218 5:181422357-181422379 GTGAACCTGCAGGATTAGGAGGG + Intergenic
1003629043 6:7770120-7770142 GTAAACTTCAAGAATGAGCTTGG + Intronic
1003864803 6:10353217-10353239 GTGAACGTAAAGAATTATGAAGG - Intergenic
1004375222 6:15085300-15085322 CTGATTTTGAAGAATGAGGAAGG - Intergenic
1006275325 6:33000753-33000775 GTGAGCTTGAAGAATGACTGGGG - Intergenic
1007036133 6:38675514-38675536 ATGAATTTAAAGAATGAGCAAGG + Intergenic
1007451659 6:41944786-41944808 GTGAACCTGTAGTATGGGGACGG + Intronic
1008009262 6:46445827-46445849 GTGAACTTGAAGACAGAGACAGG + Intronic
1008421723 6:51308818-51308840 GTGAGCATGATGAGTGAGGATGG - Intergenic
1010947215 6:81989691-81989713 ATCAACCTGAACAATGAGGAGGG + Intergenic
1011255081 6:85412195-85412217 GGGAACTTCAAGAATGAAGAGGG - Intergenic
1011675317 6:89727671-89727693 GTTTTCTTTAAGAATGAGGAAGG - Intronic
1012084355 6:94805158-94805180 GTGATTTTGAAGATGGAGGAAGG - Intergenic
1012595821 6:101037660-101037682 GGGACCTTGAAGAAAGAGGAGGG + Intergenic
1013078299 6:106790283-106790305 TAGCACTTGAAGAAAGAGGATGG + Intergenic
1013636831 6:112037105-112037127 AAGACCTTGAAGAATGAGTAGGG - Intergenic
1013670802 6:112400230-112400252 GTGGAATTAGAGAATGAGGAAGG - Intergenic
1014707026 6:124760242-124760264 GTCTACTTGAAGCAGGAGGATGG + Intronic
1014977620 6:127908335-127908357 AGGAACTTCAAGAATTAGGAAGG + Intronic
1015039134 6:128695446-128695468 GTGAACTGGAATACTGAAGATGG + Intergenic
1015193642 6:130500944-130500966 GAGAATTTCAAGACTGAGGAAGG + Intergenic
1015371760 6:132462227-132462249 GTGAACCCTAAGAATAAGGAAGG - Intronic
1015506777 6:133996719-133996741 GTGAACTTGAAGAATGAGGAAGG - Intronic
1017267767 6:152470141-152470163 GTGAACTTGATGAAGTAGGCAGG + Intronic
1017332153 6:153212213-153212235 ATGAACTTCAATAATGAGGAAGG - Intergenic
1018449192 6:163890891-163890913 GAGGAGTTGAAGAAGGAGGAGGG - Intergenic
1019116795 6:169771618-169771640 GAGGACTTGAGGAATGAAGATGG - Intronic
1019244328 6:170697916-170697938 GTGAACCTGCAGGATTAGGAGGG + Intergenic
1019491558 7:1316195-1316217 TAGGAATTGAAGAATGAGGATGG + Intergenic
1019951543 7:4377105-4377127 GGGAGGTTGAAGAAGGAGGATGG + Intergenic
1020220526 7:6233110-6233132 GAGAACATTTAGAATGAGGAAGG - Intronic
1020410262 7:7884468-7884490 TTGAACTTCAAGGAGGAGGAAGG + Intronic
1020419543 7:7986006-7986028 GTAAACTTGTAGAATGTGTAAGG - Intronic
1021067669 7:16197112-16197134 GTGAACCTGAAGAATGCTGGAGG + Intronic
1021123151 7:16819728-16819750 GTGAACTACAAGAGTGGGGAGGG - Intronic
1021952815 7:25791629-25791651 GGGAACTACAAGAAGGAGGAGGG - Intergenic
1022149642 7:27588250-27588272 GTGAACTTGGAAAATGTGTAAGG + Intronic
1022461468 7:30612441-30612463 GTGAACTTGAAGGGAAAGGAAGG + Intronic
1023569596 7:41558268-41558290 GTGATCTAGAAGCATTAGGATGG - Intergenic
1023919275 7:44614529-44614551 GTGAACTTGAAGACAGAACAAGG - Intronic
1024382332 7:48711906-48711928 ATGATATTGAAAAATGAGGACGG - Intergenic
1024637967 7:51306061-51306083 TTGTACTTGATGAATGAAGATGG + Intronic
1025214969 7:57048685-57048707 GTGAACTAGAAAAATGAAAAGGG - Intergenic
1025656983 7:63528132-63528154 GTGAACTAGAAAAATGAAAAGGG + Intergenic
1025849278 7:65232792-65232814 GAGAAATGGAAGAATTAGGATGG - Intergenic
1026207786 7:68273249-68273271 ATAAACTTGAAGAAACAGGAAGG - Intergenic
1028372098 7:90103957-90103979 CTGGACTTGAAGAAGGAGAAAGG - Intergenic
1031013254 7:116546062-116546084 GCGAACTTGAACAGAGAGGAGGG - Intronic
1032203163 7:129837657-129837679 GTGAGTTTGAGAAATGAGGAAGG + Intronic
1032678488 7:134156502-134156524 GTTATCTTGAAGAATGGGTATGG + Intronic
1032957605 7:136989611-136989633 TTGAATTTGGAGAATGAGGGAGG - Intronic
1033509086 7:142036620-142036642 GGAATCTTAAAGAATGAGGAAGG + Intronic
1034415010 7:150959685-150959707 GTGCCCGTGAAGAACGAGGATGG - Exonic
1034902923 7:154918735-154918757 GTGTGAATGAAGAATGAGGAGGG + Intergenic
1035503797 8:110256-110278 GTGAACCTGCAGGATTAGGAGGG - Intergenic
1036217317 8:6891472-6891494 GGGAGCTTGAAGAATGGGTAGGG + Intergenic
1038251572 8:25910078-25910100 GTGAATTTGAACACTGAGGTCGG - Intronic
1039096228 8:33889245-33889267 GTGAACTTGAAGAATTAGCTAGG + Intergenic
1039623683 8:39025396-39025418 GTGAACATGAGGAGTAAGGATGG - Intronic
1040033978 8:42851079-42851101 GTGAGGTTGAAGAAGCAGGAAGG - Intronic
1040449910 8:47534620-47534642 GTCAACTTGAAGAGGGAGGGTGG + Intronic
1041540493 8:58979394-58979416 GTTAATTTGATGAATGTGGATGG + Intronic
1041803800 8:61828014-61828036 GTGCACTTGTAGGAGGAGGAGGG + Intergenic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042449307 8:68925867-68925889 CTCAATTTCAAGAATGAGGAAGG + Intergenic
1044542973 8:93428620-93428642 GTGAACTAGAATAAGCAGGAAGG + Intergenic
1046329671 8:112698577-112698599 GTGTACTTAAAGAATGATGGTGG + Intronic
1047367306 8:124223202-124223224 GTGACTTTGAAGAATCAGCAGGG + Intergenic
1050625816 9:7502603-7502625 GTGAAGTAGAATTATGAGGAAGG + Intergenic
1050765919 9:9133805-9133827 GTGCACATGTAGAATGAGAAAGG + Intronic
1050862086 9:10447738-10447760 TCTTACTTGAAGAATGAGGAAGG - Intronic
1051288586 9:15522281-15522303 GTGAACTTCTAGGAGGAGGAAGG - Intergenic
1055017017 9:71629698-71629720 CTGAAATTGAAGAAAGAGCAAGG + Intergenic
1055082138 9:72277899-72277921 GGGAACTGGAAGAATGAGCAGGG + Intergenic
1055502335 9:76913846-76913868 GTGAGGTTCAAGAATGATGAGGG - Intergenic
1055796012 9:79975617-79975639 ATCAACTTGAAGAATGATGAAGG + Intergenic
1055844461 9:80544680-80544702 TTTGACTTGAAGATTGAGGAAGG - Intergenic
1057319796 9:94002040-94002062 GTGAACATGGAGTCTGAGGATGG - Intergenic
1057828027 9:98386106-98386128 GTGAACTTGACAAAGGAGGCAGG - Intronic
1057879731 9:98784088-98784110 GTGAACTTGGTCAATGGGGACGG - Exonic
1058151802 9:101471985-101472007 TAGAGCCTGAAGAATGAGGATGG - Intergenic
1058169714 9:101665761-101665783 GTGAATTTGAAAAATGAAAAGGG + Intronic
1058377155 9:104336038-104336060 CTAAACTTGAAGAAAGAGGAAGG + Intergenic
1058568451 9:106312800-106312822 GAGAAAATGAAGAATGAGAAGGG + Intergenic
1058957536 9:109963100-109963122 TTGTTCTTGAAGAATGAGTATGG + Intronic
1059687648 9:116652792-116652814 GTGCACATGAAGAAAGAGGCAGG - Intronic
1060177258 9:121506138-121506160 TTTAACTTGAAGAATGGAGATGG + Intergenic
1060199067 9:121641269-121641291 GGGGATTTGAGGAATGAGGATGG + Intronic
1060231179 9:121826811-121826833 GGGGCCTTGCAGAATGAGGAGGG + Intronic
1060297069 9:122350092-122350114 CTGACATTGAAGGATGAGGAGGG + Intergenic
1060517682 9:124276075-124276097 GTGAACTTCAGGAGAGAGGAGGG + Intronic
1203604516 Un_KI270748v1:47142-47164 GTGAACCTGCAGGATTAGGAGGG + Intergenic
1186024420 X:5293219-5293241 TTGAACTTGTAGCATGAGAAAGG + Intergenic
1187082723 X:16007979-16008001 CTAAATTTGGAGAATGAGGAAGG + Intergenic
1187789797 X:22937773-22937795 GATGACTTGAAGGATGAGGATGG - Intergenic
1190582774 X:51904346-51904368 GGGAACCTGAAGAAGGAAGAGGG + Intergenic
1191078091 X:56477813-56477835 ATGAAATTTCAGAATGAGGAGGG + Intergenic
1192278298 X:69656029-69656051 GTGAGCTTGAGAAATTAGGAGGG - Intronic
1192724780 X:73737691-73737713 CTGACCTTGTAGAATGAGTAAGG + Intergenic
1193731656 X:85109630-85109652 GTGTAAGTGAAAAATGAGGACGG - Intergenic
1194086961 X:89539496-89539518 GACAATTTGAAGAGTGAGGAGGG - Intergenic
1196313984 X:114201527-114201549 GTGAACTTGAAGAAAGTAAATGG + Intergenic
1197546259 X:127828263-127828285 GGGAACTTGAAGGAGGAGAAAGG - Intergenic
1197923847 X:131626064-131626086 GAGAATTTAAAGAAGGAGGAGGG + Intergenic
1198724462 X:139662788-139662810 GTGAATTTGGAGAAGGGGGAGGG - Intronic
1198742783 X:139858437-139858459 GAGAACATGTAGAATGATGAAGG - Intronic
1198869935 X:141167244-141167266 GTGATGGTGAAAAATGAGGATGG + Intergenic
1201458095 Y:14193350-14193372 CAGGTCTTGAAGAATGAGGAAGG + Intergenic
1201916898 Y:19191550-19191572 GGGAGGTTGAAGAATGAAGATGG + Intergenic
1202386727 Y:24333555-24333577 GTGAACCTGCAGGATTAGGAGGG + Intergenic
1202484058 Y:25336573-25336595 GTGAACCTGCAGGATTAGGAGGG - Intergenic