ID: 1015509148

View in Genome Browser
Species Human (GRCh38)
Location 6:134020314-134020336
Sequence TTGTGTAAATAGAGGTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015509148 Original CRISPR TTGTGTAAATAGAGGTATGA AGG (reversed) Intronic
903360682 1:22775186-22775208 TTGTGAAAATAGATGGATGTGGG + Intronic
903980290 1:27181695-27181717 TTGTTTAAAAAGAGGGATGTCGG + Intergenic
907845475 1:58201997-58202019 TTGTGTAAATTGGGGCATGGAGG - Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908677170 1:66618315-66618337 TTGTGTATATAGATGCATTAGGG - Intronic
909620772 1:77664146-77664168 TTGTTTAAATAGAATGATGATGG - Intronic
910313896 1:85859736-85859758 TTGTGTATCTAGAGGTTTGCAGG + Intronic
913166902 1:116196412-116196434 TTATGTAAATAGAGATAGGGAGG + Intergenic
913207619 1:116555567-116555589 TTTTTTAAATAAAGATATGAGGG + Intronic
915377817 1:155412858-155412880 TTCTGTAACCAAAGGTATGAGGG - Intronic
915790233 1:158661655-158661677 TTGTTGAAAGATAGGTATGAAGG + Intronic
916114822 1:161477632-161477654 TTGTGGAAAATGGGGTATGAAGG + Intergenic
919335982 1:196234442-196234464 CTATGTAAATAGATTTATGAAGG - Intronic
920436831 1:205952350-205952372 TCCTGTAAATAGAGGTCTGGAGG + Intergenic
922085883 1:222346481-222346503 TGGTTTAACTAGAGGTAGGAAGG + Intergenic
922537599 1:226392687-226392709 TTTGGTAAATAGAAGTATAATGG - Intronic
923744574 1:236687769-236687791 TTTGGTGAATAGGGGTATGATGG + Intronic
924090915 1:240499776-240499798 TTTTGTAAATAAAGTTATGTTGG + Intronic
1062825521 10:565484-565506 TTGTTTAAAAAGAGCTAAGATGG - Intronic
1063467483 10:6256559-6256581 TTGTGGAAAGAGAGGTGTGGTGG - Intergenic
1064692725 10:17934369-17934391 TTGTGTAAAAAGAAACATGAGGG - Intergenic
1070252479 10:74785004-74785026 ATGTGTACATTGAGGTGTGAGGG - Intergenic
1073653635 10:105388427-105388449 TTGTGTGTATATATGTATGAAGG - Intergenic
1073971136 10:109046327-109046349 TTGTGGAAAATGGGGTATGAAGG + Intergenic
1079568206 11:21909343-21909365 AAGTGTAAATAGAGGTCAGAAGG - Intergenic
1084343538 11:68526565-68526587 GTGTGTGAATAGAGGTAAGATGG - Intronic
1088257865 11:107917652-107917674 TTGTGAGAATAGAGGGATTAAGG + Intronic
1089814444 11:121159924-121159946 TTGTGTAAATAAAGCTTTGCTGG + Intronic
1090115077 11:123961879-123961901 TTCTGTAAGTATAGGTATGCTGG - Intergenic
1090823470 11:130366081-130366103 TTGTGTAAATAGCCCCATGATGG - Intergenic
1093833658 12:23798908-23798930 TTGTATACAATGAGGTATGATGG + Intronic
1098291582 12:68961809-68961831 TTATTTAAATAGACTTATGATGG - Intronic
1099992743 12:89743238-89743260 TTGTGGAAATAGCAGAATGACGG + Intergenic
1100219987 12:92494325-92494347 TTGTCTAAATTGAGATGTGATGG + Intergenic
1101546503 12:105718363-105718385 TTGTGAAAATAAAGGTGGGAGGG - Intergenic
1104105560 12:125655645-125655667 TTGTATAAATACAGCTATGTTGG - Exonic
1104313593 12:127676601-127676623 GGATATAAATAGAGGTATGAGGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1108198104 13:48015378-48015400 TAGTGTAAGTAGAGGTGTAAGGG + Intergenic
1109095582 13:58110763-58110785 TTGTGTAAATTGTGATATTATGG + Intergenic
1109249740 13:60004992-60005014 TTGAGTGAATAGAGGTAGGGAGG - Intronic
1111086934 13:83387909-83387931 TTGTGTAACTAAAGCTATTATGG - Intergenic
1112105028 13:96231042-96231064 AGGTGGAAAGAGAGGTATGAAGG + Intronic
1112755366 13:102626505-102626527 GTGTGTACCTAGAGGTAGGATGG + Intronic
1112834252 13:103494274-103494296 TTATTTAAATAGAGATATGATGG - Intergenic
1113078273 13:106490149-106490171 TTGTGTACATAGAGCAATGTTGG - Exonic
1113334294 13:109363521-109363543 TTTTGTAACTAAAGGTATGTGGG - Intergenic
1114284153 14:21224077-21224099 TTGTTTATATATATGTATGAAGG - Intronic
1115015798 14:28612165-28612187 TTGTGTCAATAAAGGTAAAATGG - Intergenic
1116400018 14:44495275-44495297 TTGTGCTAATAGAAGTGTGAGGG - Intergenic
1117391380 14:55266127-55266149 TAGTGTAATTAGTGTTATGAAGG + Intergenic
1118054370 14:62063854-62063876 GTGTGTTAATAAAGGGATGAAGG + Intronic
1119552462 14:75524941-75524963 TTTGGTAAATAGAGGGATGGAGG + Intronic
1120019537 14:79512769-79512791 TGGAGTAAATGGAGGTATAATGG - Intronic
1120085738 14:80270619-80270641 TTATGTAAATAAATGTATAATGG + Intronic
1120110161 14:80544713-80544735 ATATGAAAATAGAGGAATGATGG - Intronic
1126704917 15:51397683-51397705 TTGTTTTAATAGAGGGAGGAGGG + Intronic
1126801162 15:52297757-52297779 ATGTGTGAATAGAGGTAAGGAGG + Intergenic
1127001841 15:54517928-54517950 TTGTATAAATAGAGGTAAAAAGG + Intronic
1128606364 15:69039355-69039377 TTCTGTAACTAGAGCTATGGGGG + Intronic
1133666836 16:7976761-7976783 TTTTGTAAATAGAGTTATATTGG + Intergenic
1134365531 16:13574225-13574247 TTATTTAAATAGAGGGATGAGGG - Intergenic
1139030035 16:62868753-62868775 GTGAGGAAATAGAGGTTTGAAGG - Intergenic
1139758735 16:69166897-69166919 TTTTCTGAATAGAGGTATTATGG + Intronic
1143960735 17:10716342-10716364 TTATGTACATAAAAGTATGATGG - Intronic
1145125606 17:20297685-20297707 TTTTGTAAATAAAGGTTTGTTGG - Intronic
1147601750 17:41750821-41750843 TTGTGTTAATCCAGGTATGGTGG - Intergenic
1148701475 17:49589549-49589571 TTGGGTAAATAGAGGGTAGACGG + Intergenic
1150289998 17:63975609-63975631 TTGTGAAAATGGAGGTAGCATGG - Intergenic
1153117065 18:1671333-1671355 ATGTGGAAATAGATGAATGAAGG + Intergenic
1156249034 18:35333022-35333044 TGGTGAAAATACAGTTATGAAGG + Exonic
1157628096 18:49068419-49068441 TTGTTTAAAGAAAGGTATGAAGG - Intronic
1158179918 18:54702765-54702787 TTGTGTAAAAAGAGTGTTGATGG + Intergenic
1163876039 19:19868726-19868748 TAGTGTAAATAATGGTTTGATGG + Intronic
1164411681 19:28011387-28011409 TTGTGTGTAGAGAGGAATGAAGG + Intergenic
1164937946 19:32229533-32229555 TTGTGTGGATAGAGGTATCTGGG + Intergenic
1167981683 19:53281429-53281451 TTGGGTAAATAGGGGTAGGAGGG + Intergenic
1168406017 19:56111149-56111171 TGATGTAAATAAAGGAATGAGGG + Intronic
925354941 2:3234047-3234069 TTGTGTAAATAAAGTTCTGTTGG - Intronic
925378293 2:3404738-3404760 TTGAGTAAATAAAGGGATGAGGG + Intronic
928591992 2:32826590-32826612 TTCAGTAAATAGAGTGATGAAGG - Intergenic
930668498 2:54123397-54123419 TTCTACAAATAGAGGTAGGAAGG + Intronic
931071003 2:58650034-58650056 TTGTGTAAAGAGAGGTGTCATGG - Intergenic
931114206 2:59147197-59147219 TTTTGTTAATAGATATATGAGGG + Intergenic
935366594 2:102298100-102298122 GTGTGTGAATATAGGAATGAGGG + Intergenic
936684907 2:114816382-114816404 TTGTGTAAATAAAGTTTTGTTGG - Intronic
936706474 2:115080496-115080518 TTCTGTAAATAGAGTTTTGTCGG + Intronic
937583167 2:123513929-123513951 TTGTGTACATAAAGGCATGCAGG - Intergenic
940924315 2:159346773-159346795 TTTTGTAAAGAGGGGTATAAAGG - Intronic
941522041 2:166557538-166557560 TTGTGTTACTACAGGAATGAAGG - Intergenic
942877767 2:180822857-180822879 TTATGTATATAGACGTAAGAGGG - Intergenic
943057079 2:182995104-182995126 TTTTTTAAAGAGAGGTTTGAGGG - Intronic
943952722 2:194150857-194150879 TTGTGTGAATAAAGAAATGAAGG - Intergenic
944430593 2:199629443-199629465 TGGTGTGAATAGCAGTATGAGGG + Intergenic
944682166 2:202087066-202087088 TTGTGTAAATAGAGTTTTATTGG + Intronic
945633379 2:212313948-212313970 TTGTTTAAATTGTGGGATGAAGG - Intronic
945729026 2:213509507-213509529 ATGAGTAAATAGAGGTTAGATGG - Intronic
948201627 2:236133582-236133604 GTGTGTAAGTGGAGGCATGAGGG - Intergenic
1168825002 20:804497-804519 TTGTGTAAATGGACATATTATGG + Intergenic
1169582432 20:7038803-7038825 CTGTGTAAATAGAGGTAACGTGG + Intergenic
1169590532 20:7136230-7136252 TTGGTAAAATAGAGGTGTGAGGG + Intergenic
1169818435 20:9683156-9683178 TTGGGTAAATAGAAATGTGAGGG - Intronic
1171231168 20:23486938-23486960 TTGTGTAAATGGTGGAAGGAAGG + Intergenic
1171249041 20:23634862-23634884 GTGGGTAGATAGATGTATGAGGG - Intronic
1173693144 20:44981524-44981546 TTTTGTCAATAGTGCTATGATGG + Intronic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1178441695 21:32603608-32603630 GTGTTTAAATCGAGGTATAAAGG + Intronic
1179280274 21:39927940-39927962 TTTTTTAAATACAGGCATGAGGG - Intronic
1182488768 22:30655707-30655729 TTCTGTAAATAGAGGTCTGTGGG + Intronic
949248576 3:1955153-1955175 TTGTGTAGATGTAGGTATAATGG - Intergenic
955134840 3:56206595-56206617 GTGTATAAATATAGGTATGAGGG + Intronic
955199993 3:56842982-56843004 TTGTATAACTAGAAGTTTGAGGG - Intronic
956275268 3:67493370-67493392 TTGGGTAGATAAAGGTATGTGGG - Intronic
956603040 3:71043525-71043547 TTGAGTAAACAGTGGTCTGAGGG - Intronic
958263054 3:91404572-91404594 TTGTGTATAAAGAGGGATCATGG - Intergenic
958691762 3:97477909-97477931 CTGTGAAAAAATAGGTATGATGG + Intronic
958725025 3:97894912-97894934 TCCTGTAAGTATAGGTATGACGG - Intronic
960470069 3:118052994-118053016 TTGTGTAACTTAAGGTATAATGG + Intergenic
960706563 3:120488068-120488090 TTTTGTAGATGGAGATATGAAGG - Intergenic
962083220 3:132162845-132162867 TTGTGTAAATACATGCATGATGG - Intronic
962885370 3:139620661-139620683 TTGTGTAAATAGAAATAGAATGG + Intronic
963415572 3:144991789-144991811 CTGTGAAAATACAGGTTTGAAGG - Intergenic
964098170 3:152957817-152957839 CTGTGTAGACAGATGTATGAGGG - Intergenic
967750217 3:193105440-193105462 TTGTGTAAATAGTGAAATTAAGG - Intergenic
967785425 3:193488609-193488631 TTGTTTAAATGGAGTCATGAGGG + Intronic
969378355 4:6778155-6778177 TGCTGTAAATAGAGCGATGAGGG + Intergenic
970376839 4:15467350-15467372 TTGTGCAGGTAGAGGTAGGATGG + Intergenic
970503175 4:16699502-16699524 TTGTGTAATTAGGTATATGATGG + Intronic
973101619 4:46278911-46278933 TGGTATCAATAAAGGTATGAAGG + Intronic
974157046 4:58087033-58087055 TTATATAAATAGAGAAATGATGG + Intergenic
974237815 4:59205055-59205077 TTCTTTAAATAGAGGAATCAAGG - Intergenic
975320140 4:73000759-73000781 TTGTGTAAATATAATTATGTAGG - Intergenic
975387960 4:73780746-73780768 CTGTGTTGATAGAGGTAGGAAGG + Intergenic
976062580 4:81146220-81146242 TTTTCTAAATAGAGGTGAGATGG + Intronic
976098022 4:81529287-81529309 TTGTGTAAGTGGATGGATGATGG + Intronic
977407447 4:96617967-96617989 TTGTGTAAGTAGAGGAACAATGG + Intergenic
978113450 4:104990934-104990956 TTGAGTGAATAAATGTATGATGG - Intergenic
980323305 4:131307433-131307455 TTGTGAAGTTAGAGGTTTGAGGG - Intergenic
981261396 4:142724069-142724091 TTATGTAAATAAAGGAATCAAGG - Intronic
982139075 4:152300203-152300225 TTGAGTTAATAATGGTATGAAGG - Intergenic
983807352 4:172011655-172011677 TTCTGTAACTAGAGGTTTAAGGG - Intronic
984579392 4:181493878-181493900 TATGGTAAATAGAGGTATGGAGG - Intergenic
985198380 4:187458447-187458469 TTGGGTAATTAGATGTATGATGG - Intergenic
985842521 5:2319229-2319251 TTGTTGCAATAGAGGCATGAGGG + Intergenic
986868553 5:12018873-12018895 GTATGGAAATAGAGCTATGAGGG - Intergenic
986874418 5:12090388-12090410 TTTTATAAATAGAGGTAAAAGGG - Intergenic
987656135 5:20808701-20808723 TTGTATAAATTGCTGTATGATGG - Intergenic
987656927 5:20819160-20819182 TTCTGTAAATAGAGTTTTGTTGG + Intergenic
988237610 5:28565610-28565632 TGGTCTAAATAGAGGTTTTATGG + Intergenic
988766626 5:34384788-34384810 TTCTGTAAATAGAGTTTTGTTGG - Intergenic
990315541 5:54579526-54579548 CTCTGTAAATAGATGGATGAAGG - Intergenic
991386940 5:66101124-66101146 TTGTGTAACCAGGAGTATGATGG - Intergenic
992537910 5:77730195-77730217 TTTTGTAGATATAGTTATGATGG + Intronic
992904194 5:81329470-81329492 TTGTGTGAATAGATGGGTGAGGG + Intergenic
993345292 5:86775547-86775569 TTGGGTAAATAAAGAAATGAAGG - Intergenic
993917042 5:93756147-93756169 TTGTGTACCTAGAGGGATTATGG - Intronic
994609799 5:102021543-102021565 TTGAGTAAATAACGATATGAAGG + Intergenic
994848016 5:105015495-105015517 TTTTGTAAATAAAGTTTTGAGGG - Intergenic
995537169 5:113148341-113148363 TTTTGAAAATAGTGATATGAAGG - Intronic
995913131 5:117212021-117212043 TTGGGTAAATTGAGGTATTTAGG - Intergenic
996434663 5:123421608-123421630 TACTGTAAATATAGGTTTGAGGG - Intronic
1000064780 5:157685160-157685182 TTCTGTAATTAGAGGTCTGTGGG + Intergenic
1000717435 5:164663374-164663396 TTAAGTAAATAGAGATGTGAGGG - Intergenic
1000952573 5:167502130-167502152 TTGAGTAAATATATGTATGCTGG - Intronic
1001552714 5:172616092-172616114 ATGTGTAATTAGAGGAGTGAAGG + Intergenic
1002554321 5:180023054-180023076 TTAAGTAAATAGATGTAGGATGG + Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003868626 6:10384618-10384640 TTGTTTAAAAAGACGTAAGAAGG + Intergenic
1006762879 6:36478888-36478910 TTGTGTACAAAGAAGAATGAAGG - Intronic
1008992353 6:57618316-57618338 TTGTGTATAAAGAGGGATCATGG + Intronic
1009180976 6:60517428-60517450 TTGTGTATAAAGAGGGATCATGG + Intergenic
1009709349 6:67297909-67297931 TTGTGTAAATAATGAAATGAAGG - Intergenic
1010508352 6:76687634-76687656 CTGTGGAATTAGAGGTATTACGG + Intergenic
1011933438 6:92742290-92742312 TTGTATGAATAGAGGCTTGAAGG + Intergenic
1013623648 6:111916195-111916217 ATGTGTATATAAAGGTATAAAGG + Intergenic
1014275650 6:119385261-119385283 TGGTCTACACAGAGGTATGAAGG + Intergenic
1015056810 6:128912346-128912368 TTGTGTAAAAAGAGGGAGAAAGG - Intronic
1015509148 6:134020314-134020336 TTGTGTAAATAGAGGTATGAAGG - Intronic
1018122753 6:160653108-160653130 TAGTGAAAATAGAGCTGTGAAGG + Intronic
1020359111 7:7308168-7308190 TTGTTTAAATAGAGGAACCAGGG - Intergenic
1021481214 7:21119598-21119620 TAGTGGAAATAAAGGTATAAAGG + Intergenic
1021508250 7:21408615-21408637 ATGAGGAAGTAGAGGTATGAAGG + Intergenic
1025284210 7:57649384-57649406 GTGTGTAAACAGAGGAATGTGGG + Intergenic
1026903282 7:74048647-74048669 TTGAGTAAATGGGGGTATGTAGG - Intronic
1027731419 7:81878444-81878466 TTGGGCAAATAGAGGCAAGAAGG + Intergenic
1030834311 7:114264443-114264465 TTGTTTAAATAGGGGTGGGAGGG - Intronic
1031211816 7:118838801-118838823 TTTTTTAAAAAGAGATATGAGGG + Intergenic
1031732137 7:125312900-125312922 TTGTGGAAAACGAGATATGAAGG + Intergenic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1038595692 8:28883806-28883828 TTGAGTAAATACATGAATGATGG + Intronic
1039527101 8:38226635-38226657 TTCTGTAAATCTAGGGATGATGG + Intronic
1039603019 8:38857662-38857684 TTGTATAAAGAGAGGTGTGCAGG - Intergenic
1040604492 8:48917343-48917365 TTATGTAAAGAGATATATGAGGG - Intergenic
1041230401 8:55745098-55745120 TTGTGTAAACATAGGAATAATGG + Intronic
1041433754 8:57815508-57815530 ATGAGGAAATGGAGGTATGAAGG + Intergenic
1042746772 8:72116937-72116959 TGGTTTAAATAAAGGGATGATGG - Intronic
1042884810 8:73536673-73536695 TGGTGTCAATAGAGGCATGGTGG + Intronic
1043330686 8:79114829-79114851 CTGTGTAAATAACGATATGAAGG + Intergenic
1044186507 8:89259140-89259162 TTGTATAAATAGAACTAAGATGG - Intergenic
1044429116 8:92087965-92087987 TTGTTTAAATAAAGGTAGGTAGG - Intronic
1047871185 8:129083849-129083871 ATATTTAAATCGAGGTATGAAGG + Intergenic
1051165978 9:14262299-14262321 TTGCGTAGGTAGAGGTTTGATGG - Intronic
1051484725 9:17595806-17595828 TTGTAAAAATATAGCTATGATGG + Intronic
1051751170 9:20342509-20342531 TTCTGAAAATAGAGTTATGATGG - Exonic
1051793408 9:20835087-20835109 GTATGTAAATACAGGTATAAAGG - Intronic
1053235485 9:36450176-36450198 TTTTGGAAATAGAGTGATGATGG - Intronic
1055797900 9:79995496-79995518 TTTTTTAAATGGAGTTATGATGG - Intergenic
1057292275 9:93814289-93814311 TTGTGTAAACAGAGGGCTTAGGG - Intergenic
1186204069 X:7182895-7182917 TTTTGGAAATAGAGTTATGGTGG + Intergenic
1186630109 X:11339512-11339534 GTGAGGAAATGGAGGTATGATGG - Intronic
1186655814 X:11610637-11610659 TTTTGTAAACAGATTTATGAAGG + Intronic
1187654435 X:21454095-21454117 ATGTGTAAATTGAGGTTGGAAGG - Intronic
1188081547 X:25848107-25848129 AGGTATAAATAGAGTTATGAAGG - Intergenic
1189116523 X:38348918-38348940 TTCTGTAAATAGTGGTATGCTGG - Intronic
1191047229 X:56151557-56151579 TTGTGTAACTGGATGTGTGATGG + Intergenic
1191740409 X:64431990-64432012 TTGTGTAGACAAAGGTATGAGGG - Intergenic
1192218927 X:69183601-69183623 TTGTGTAACTAGATGTAAGGGGG - Intergenic
1193248019 X:79253176-79253198 TTGGGTAGATAGAGGTGGGAAGG + Intergenic
1193758535 X:85438025-85438047 TTGGGTAAATAAAGAAATGAAGG - Intergenic
1194961780 X:100244475-100244497 GTGTTTAAATAGAGGTGAGATGG - Intergenic
1196917563 X:120553729-120553751 TTGTTTAAATAGAGATATGGGGG - Intronic
1196921023 X:120585293-120585315 TTGTGCAAATGGATGGATGATGG + Intergenic
1197856329 X:130917480-130917502 ATGTGAAATTAGAGATATGAAGG + Intergenic
1200700003 Y:6394027-6394049 TTGTGCAAATAGTGGAATGTAGG + Intergenic
1201034108 Y:9770671-9770693 TTGTGCAAATAGTGGAATGTAGG - Intergenic
1201267743 Y:12224598-12224620 TTGTGTAAATTGAGCTGTGTCGG + Intergenic