ID: 1015509187

View in Genome Browser
Species Human (GRCh38)
Location 6:134020847-134020869
Sequence CCAACGAGTTGGAGAATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015509187 Original CRISPR CCAACGAGTTGGAGAATCTC AGG (reversed) Intronic
901237955 1:7677642-7677664 CCACCGAGTTGGAGATGATCTGG - Exonic
902958251 1:19941866-19941888 ACATCGAATTGCAGAATCTCAGG - Intergenic
907494929 1:54837332-54837354 CCAACAAGTTGGTGAACATCGGG + Intronic
907712097 1:56892835-56892857 CCTACCAGTTAAAGAATCTCAGG + Intronic
914801106 1:150963242-150963264 CCTAAGAATTGGAGCATCTCTGG + Intronic
914832781 1:151182760-151182782 CCAACGAGTTGGAGAAACCCAGG - Intronic
918451253 1:184661300-184661322 GCAACCAGGTGAAGAATCTCCGG - Intergenic
919542417 1:198866291-198866313 CTAAAAAGTTGCAGAATCTCAGG - Intergenic
921361988 1:214339040-214339062 CCAAAGAGTTAGAGAATAGCTGG - Intergenic
924589719 1:245392153-245392175 CGAAAGAGTTTGAGAATCACCGG + Intronic
1063971034 10:11381367-11381389 CCAGAGAGTTGGAGAATGTGCGG + Intergenic
1065111986 10:22449336-22449358 CCAAGGAGTTGGAGGATTGCTGG + Intronic
1071138104 10:82475333-82475355 CCAACAAATTGGATAATCTAGGG + Intronic
1071922973 10:90372195-90372217 CCAAAGAGTTGGAGAACTGCTGG + Intergenic
1073109635 10:101053735-101053757 CAAACCACATGGAGAATCTCAGG - Intergenic
1078504477 11:11923475-11923497 CCACAGAATTGGATAATCTCTGG + Intronic
1078809427 11:14743411-14743433 CCACCAAGTTGGAGCATCACAGG + Intronic
1079747042 11:24146706-24146728 CCAAGGATTTGGAAGATCTCTGG - Intergenic
1095350117 12:41200323-41200345 CCACCTAGTTGGAAAATCTGAGG - Intronic
1096642782 12:53007251-53007273 CCCACGTGTTGGAGAAGCACCGG + Intronic
1098740838 12:74171485-74171507 CCGACGAGCTGGAGAAGTTCTGG + Intergenic
1100610478 12:96187848-96187870 CCAAAGAGGTGGAGAATAGCTGG - Intergenic
1100887949 12:99093181-99093203 TCAATGTGTTGGAGAAACTCTGG - Intronic
1104634425 12:130428659-130428681 CCAATAAGTTGGAGAAGCTGAGG - Intronic
1108835442 13:54540694-54540716 CCAATTACTTGGAGAATCTTAGG + Intergenic
1118969875 14:70625930-70625952 CCAACAAATTGGATAATCTAGGG + Intergenic
1119398227 14:74344296-74344318 CCAGCCAGTTGGAGAAGCTGAGG + Intronic
1121488357 14:94339041-94339063 TCAAAGAGTTGGAGGATCTCAGG - Intergenic
1126339780 15:47626485-47626507 CCAAAGACTTGGAGAAACTGAGG + Intronic
1127283795 15:57515336-57515358 CTAACCAGTTAGAGAATTTCAGG - Intronic
1145126783 17:20307505-20307527 CCAATGAGCTGGAGAAACCCAGG - Intronic
1150238284 17:63610958-63610980 CCAGTGAGTTGGAGAAGTTCCGG - Intergenic
1153383244 18:4461624-4461646 CCAAGGAGTGGGAGAATTTCAGG + Intergenic
1154112648 18:11583644-11583666 CACACGAGTTGGGGAAGCTCTGG + Intergenic
1159095216 18:63894375-63894397 CCAGCAAGTTGGTGAATTTCTGG - Intronic
1168496481 19:56855573-56855595 CCAAAAAGCTTGAGAATCTCTGG + Intergenic
926907236 2:17816904-17816926 CCAGCGAGAGGGAGAAGCTCAGG + Exonic
933845024 2:86318702-86318724 CCAACAAGTTTGAGAACCACTGG + Intronic
935051441 2:99528368-99528390 CCAACTGTTTGGAGATTCTCAGG + Intergenic
935206980 2:100904610-100904632 CCAACAAGTTTGAGAACCACTGG + Intronic
935345600 2:102104806-102104828 CCCAGGAGGTGGAGAATGTCGGG - Intronic
937858628 2:126691008-126691030 GCAATGAGTTGGAGAATGCCAGG - Intronic
937859130 2:126694595-126694617 GCAATGAGTTGGAGAATGCCAGG - Intronic
942740461 2:179170792-179170814 CCAATGATTTGGAGAGTTTCTGG + Intronic
1171467463 20:25340043-25340065 CCAAGGAATTTGAGAATCACCGG - Intronic
1172200745 20:33124408-33124430 GCATCCAGTTGGAGAACCTCAGG - Intergenic
1173945987 20:46951387-46951409 CAAACGACTTAGAGAATTTCTGG - Intronic
1178172163 21:30053498-30053520 ACAAAGAGTTTGAGAATCTATGG - Intergenic
949951220 3:9230360-9230382 CCATCCAGTTTGAGAATGTCAGG - Intronic
951550715 3:23872513-23872535 CCAAAGAGTTTGAGAACCACTGG - Intronic
955988761 3:64602459-64602481 CAAATGAGTTGGAAAATCACTGG - Intronic
963505176 3:146175994-146176016 CCAAAATGTTTGAGAATCTCTGG - Intergenic
965100273 3:164289240-164289262 CCAACAACTTGTAGAATCTCAGG - Intergenic
965318743 3:167225106-167225128 CCAACAAGTTAGAGAAACTGTGG + Intergenic
966058507 3:175727146-175727168 GCACCGAGTTGCAGAATTTCTGG - Intronic
970937622 4:21593031-21593053 CCAAGGAGTTGGAAAACCACTGG - Intronic
975678182 4:76848804-76848826 CTAAAAAGTAGGAGAATCTCTGG + Intergenic
975872288 4:78793591-78793613 CAAAAGACTTTGAGAATCTCTGG + Intronic
977822506 4:101490748-101490770 CCAAGGAGGTGAAAAATCTCTGG - Intronic
982909223 4:161118098-161118120 CCACCAAGCTGGAGCATCTCAGG + Intergenic
986959049 5:13191305-13191327 CAAATGAGTTGGAGATTATCAGG + Intergenic
989362077 5:40613228-40613250 CCATCGAGTTTGGGAATCACTGG - Intergenic
992526055 5:77611604-77611626 CCAACGAGAACAAGAATCTCTGG + Intronic
996427920 5:123335197-123335219 CCACCAAGCTGGAGCATCTCAGG + Intergenic
1003104155 6:3201713-3201735 CCAAACAGTTTGAGAATCGCTGG + Intergenic
1004990012 6:21126315-21126337 CCATCAAGTTTGAGAATCTCTGG - Intronic
1005573163 6:27166694-27166716 CCCAGGAGTTGGAGAATTTGGGG - Intergenic
1009899341 6:69792897-69792919 CCAAAAAGTTTGGGAATCTCTGG - Intronic
1011018525 6:82785104-82785126 CCAAAGTGTTTGAGAATTTCTGG + Intergenic
1013146596 6:107400305-107400327 TCAATGATTTGGAGAATCTCTGG + Intronic
1014383680 6:120775799-120775821 CCAAACAGTTGGAGAATTACAGG + Intergenic
1015509187 6:134020847-134020869 CCAACGAGTTGGAGAATCTCAGG - Intronic
1019500675 7:1363028-1363050 CAACCGAGATGGAGAACCTCAGG - Intergenic
1023488354 7:40711118-40711140 CCAACGGGTGTGAGAAACTCAGG + Intronic
1024924422 7:54598342-54598364 CTAACGACTTGGAGAATATGAGG + Intergenic
1029883553 7:103843021-103843043 CCAAGGAGTTGTGGAATCTTGGG + Intronic
1031999328 7:128254552-128254574 CCAACGACCTGGAGAACCTCCGG + Exonic
1032656045 7:133930711-133930733 CCAATAAGTTGGAGACTCACAGG - Intronic
1043051544 8:75392186-75392208 ACAATTAGTTTGAGAATCTCTGG + Intergenic
1045683302 8:104685755-104685777 ACAAGGAGTAGGTGAATCTCAGG - Intronic
1046347287 8:112948153-112948175 CCATCAAATTGGAAAATCTCTGG + Intronic
1046757509 8:117987325-117987347 GCAAGGAGTTGGAGGATCTGGGG - Intronic
1050806057 9:9679666-9679688 CTAACAAGTTGGAGAATCTAGGG - Intronic
1056268272 9:84921453-84921475 TCAATGAGTTGCAAAATCTCTGG - Intronic
1059950257 9:119454861-119454883 CCAACCATTTGGACAACCTCAGG + Intergenic
1060829107 9:126702715-126702737 CTAACGACTTGGAGGACCTCCGG + Intergenic
1061633716 9:131891583-131891605 CAAACAAGTTTGAGAAACTCTGG - Intronic
1186415874 X:9382595-9382617 CCAAGGAGTTTGAGCATCTCTGG - Intergenic
1190576816 X:51847715-51847737 CAAACTAGTCGGAGATTCTCCGG + Intronic
1191088717 X:56597516-56597538 CCACCAAGCTGGAGCATCTCAGG + Intergenic
1191872386 X:65759309-65759331 CCAACAAGCTGGAGAATTTGGGG + Intergenic
1192059857 X:67812768-67812790 CCACCGATTTGGAGAGTCTGGGG + Intergenic
1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG + Intergenic
1200830102 Y:7680804-7680826 CCAACCAGCTGAAGAAGCTCAGG - Intergenic
1200887271 Y:8281982-8282004 CCAACCAGCTGCAGAAGCTCAGG - Intergenic
1200988578 Y:9327690-9327712 CCAACCAGCTGAAGAAGCTCAGG - Intergenic
1201060257 Y:10038148-10038170 CCAACCAGCTGAAGAAGCTCAGG - Intergenic
1202195545 Y:22296005-22296027 CCAACCAGCTGAAGAATCTCAGG - Intergenic
1202335180 Y:23801300-23801322 CCACCAAGTTGGAGTATCCCAGG - Intergenic
1202535587 Y:25868759-25868781 CCACCAAGTTGGAGTATCCCAGG + Intergenic