ID: 1015511708

View in Genome Browser
Species Human (GRCh38)
Location 6:134044161-134044183
Sequence AATATCTATGATAGCAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015511708_1015511712 22 Left 1015511708 6:134044161-134044183 CCCCCTTTGCTATCATAGATATT 0: 1
1: 0
2: 1
3: 22
4: 188
Right 1015511712 6:134044206-134044228 CAAGCCATCTCCTCCATCAAAGG 0: 1
1: 1
2: 0
3: 12
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015511708 Original CRISPR AATATCTATGATAGCAAAGG GGG (reversed) Intronic
902268029 1:15282601-15282623 ATAAACTATGATAGCAAAGAAGG - Intronic
903548615 1:24142538-24142560 CAGATCTATGATAACAAAAGGGG + Intronic
904657895 1:32062973-32062995 AAAATCCAAGAAAGCAAAGGAGG + Intergenic
905458330 1:38103910-38103932 AATATCCATGTTGGCAGAGGAGG + Intergenic
911229121 1:95341342-95341364 AAAATCAATGATAGCAAGAGGGG - Intergenic
914568952 1:148896493-148896515 AATGTGTATGATGGGAAAGGAGG + Intronic
914603875 1:149233763-149233785 AATGTGTATGATGGGAAAGGAGG - Intergenic
916209233 1:162345941-162345963 AAGATGAATGATAGCAGAGGAGG + Intronic
916305604 1:163327065-163327087 AATATCTATGGCAGCAAACAAGG + Intronic
916663645 1:166946280-166946302 AATATATATAAAAGAAAAGGGGG - Intronic
917011933 1:170484394-170484416 GATATCTGTGAAAGAAAAGGTGG + Intergenic
919645636 1:200091781-200091803 AATAACTAAGATGGCAAAGGGGG - Intronic
920821665 1:209387306-209387328 AATGGCTATGATAGCAGTGGGGG - Intergenic
922297792 1:224267000-224267022 AAGATCTATGCCAGGAAAGGTGG - Intronic
924474797 1:244373583-244373605 AATATCTATTATTAAAAAGGGGG - Intronic
1065536620 10:26721343-26721365 TAAATCTATGAGAGAAAAGGAGG - Intronic
1065539652 10:26749963-26749985 AATATATTTGATAGTAGAGGAGG - Intronic
1068564306 10:58554868-58554890 AATATATAAAATAGAAAAGGAGG - Intronic
1069105976 10:64383961-64383983 AATTTCTATGATAGAAAAAAAGG + Intergenic
1070216480 10:74387493-74387515 AATTTCTAACATAGGAAAGGAGG + Intronic
1070445354 10:76494563-76494585 AAGATCTATGAAACCAAAGTTGG - Intronic
1070839750 10:79475883-79475905 AACCTCTATGAAAGGAAAGGCGG + Intergenic
1070984046 10:80672949-80672971 AATATCTATGCTGGAAAATGAGG - Intergenic
1071204103 10:83254294-83254316 ATTATCTATAAGAGCAAATGGGG + Intergenic
1075752012 10:124780213-124780235 AATATTTATAAAAACAAAGGAGG + Intronic
1077980349 11:7293718-7293740 AATATAAATGATGGCAAAGCTGG + Intronic
1080772362 11:35353661-35353683 AATATCCCTAATAGCAAGGGTGG + Intronic
1086931110 11:92694289-92694311 CATATCTATGAAAATAAAGGTGG + Intronic
1087624207 11:100578268-100578290 AATATCTATGATATTAGAGAGGG - Intergenic
1088099189 11:106135656-106135678 AATAACTGTGATATAAAAGGAGG - Intergenic
1088529484 11:110793068-110793090 AATATCAAGGACAGCAGAGGGGG + Intergenic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1089260137 11:117218564-117218586 CAGATCTATGAAAGGAAAGGAGG + Exonic
1090040496 11:123286593-123286615 AATATCTAAACTAGAAAAGGAGG - Intergenic
1092779824 12:11975658-11975680 AATTTCTATGATATCAGAGTAGG + Intergenic
1095452615 12:42348949-42348971 AATATCTAACATACTAAAGGAGG + Intronic
1097506042 12:60471874-60471896 AATAACTAGAATAGCAAAGAAGG - Intergenic
1097579921 12:61442661-61442683 AAGTTCTATGAAATCAAAGGTGG - Intergenic
1099150268 12:79102720-79102742 AATATCAATGACAGCCAATGAGG - Intronic
1099594099 12:84636122-84636144 AATATCTTTCAAAGAAAAGGTGG + Intergenic
1099897401 12:88666554-88666576 TATATCTATGATATTAAAGATGG + Intergenic
1100112556 12:91263037-91263059 AAGAGCTATGATAGCAAGGAAGG - Intergenic
1100216398 12:92454175-92454197 AATATTTATGTTAGAAAAGAAGG + Intergenic
1100343239 12:93701697-93701719 ATTCTCTATGCTGGCAAAGGAGG + Intronic
1100920364 12:99477675-99477697 AATATCTATGATAGTAACAATGG - Intronic
1101043956 12:100785417-100785439 AATATCAATGGTTGCCAAGGTGG - Intronic
1101475032 12:105037710-105037732 AAGATCTCTGATAAAAAAGGAGG + Intronic
1101638186 12:106564950-106564972 CATATCTGTGAAAGGAAAGGGGG + Intronic
1105428026 13:20312598-20312620 AATATCTTTGACAGGAAATGAGG - Intergenic
1107952566 13:45477556-45477578 AATATCTATTATTTAAAAGGGGG - Intronic
1108199921 13:48032718-48032740 TACATCTATGATAGGATAGGAGG - Intergenic
1108421233 13:50251925-50251947 AAGAGCTATGACAACAAAGGGGG + Intronic
1109387646 13:61653472-61653494 ACTATTTATAATAGCAAAGATGG - Intergenic
1109737578 13:66506809-66506831 ATTATTTATTAAAGCAAAGGTGG - Intronic
1110516048 13:76413491-76413513 AACATCTATGAAAGAAAAAGTGG - Intergenic
1111930671 13:94510055-94510077 AATATCTTAGAAAACAAAGGGGG - Intergenic
1112157115 13:96830402-96830424 AATATCTGTGTTAGCAAAGAAGG - Intronic
1112944341 13:104908174-104908196 AATATCGATGAAAGGAAAAGTGG - Intergenic
1116530077 14:45960359-45960381 AAAATCAATGAAACCAAAGGTGG - Intergenic
1123607784 15:22053314-22053336 ATTTTCTCTGATAGCAAAGATGG + Intergenic
1123958885 15:25372887-25372909 AACATATATTATAGCAGAGGTGG - Intronic
1124900350 15:33816883-33816905 AAAATCTCTGATAGCCATGGAGG - Exonic
1125180398 15:36876691-36876713 AAGATCTTTTATAGCAAAGCAGG + Intergenic
1202980019 15_KI270727v1_random:345112-345134 ATTTTCTCTGATAGCAAAGATGG + Intergenic
1133373073 16:5260547-5260569 AACATCTAAGAAACCAAAGGTGG + Intergenic
1134659689 16:15974713-15974735 AATATCAAAGATAGCAAAATAGG + Intronic
1135191670 16:20359563-20359585 AACAGCTATGAAAGCAAAGGTGG + Exonic
1136554491 16:30999848-30999870 AAGATATATGATAGGAAATGAGG - Intronic
1136635739 16:31521766-31521788 AATCACTTTGAAAGCAAAGGGGG + Intergenic
1140919422 16:79523245-79523267 ATTCTCTACCATAGCAAAGGAGG + Intergenic
1141281689 16:82634875-82634897 AATATCTATGATCTCTATGGAGG + Intronic
1143580468 17:7822596-7822618 ATTATCTAGTATAGCAAAGACGG - Intronic
1144363033 17:14514521-14514543 AATGTCCATGAAGGCAAAGGTGG - Intergenic
1144803840 17:17950787-17950809 AAAATCTGTGACAGCATAGGTGG + Intronic
1147230115 17:39011622-39011644 ATTATCTCTGATAGGATAGGAGG + Intergenic
1149074825 17:52582954-52582976 TATATGTATGATAGTGAAGGAGG - Intergenic
1149938395 17:60833765-60833787 TATATCTATTATATCAAATGTGG - Intronic
1150534968 17:66027453-66027475 AATATTTAAAATAGCAAATGAGG - Intronic
1156641298 18:39103108-39103130 AACAACAATGACAGCAAAGGAGG - Intergenic
1156666190 18:39410317-39410339 TATATCTATTATAATAAAGGAGG - Intergenic
1158110160 18:53931900-53931922 AATAATTATCATAGCAATGGAGG + Intergenic
1158457166 18:57618405-57618427 AATTTCAATGATACAAAAGGAGG - Intronic
1168664215 19:58191049-58191071 AAAATCTTTGTTAGCAAAAGAGG + Intronic
924965377 2:71956-71978 AATATCTATGATTGAGAAGGAGG - Intergenic
925353121 2:3216638-3216660 AATATTTATGGCACCAAAGGAGG - Intronic
925961443 2:9020984-9021006 AATATATATGAAAGAAAAGGAGG - Intergenic
926312198 2:11682879-11682901 AACACCTATGACAGCAAAAGAGG - Intronic
926356136 2:12042404-12042426 AATATGTATGAAAGCAAAGGTGG - Intergenic
927429095 2:23011842-23011864 AATAATAATAATAGCAAAGGGGG + Intergenic
933415123 2:81977871-81977893 CATCTCTATGATGGCTAAGGTGG + Intergenic
933692862 2:85193111-85193133 AATATCAAGCACAGCAAAGGTGG - Intronic
934865881 2:97810492-97810514 AACATCTATGAGGGCAAAGGTGG + Intronic
935821993 2:106902564-106902586 CATATCTCTGATTACAAAGGAGG - Intergenic
939312393 2:140499344-140499366 AATGTCTATGATAACAAACTTGG - Intronic
940091260 2:149921226-149921248 AATATCTATACTACCAAAAGTGG + Intergenic
942759441 2:179381023-179381045 AAAATCAATGAAACCAAAGGTGG + Intergenic
943852866 2:192749897-192749919 AATGAAAATGATAGCAAAGGTGG + Intergenic
945647020 2:212509745-212509767 AATATCAATGGTAACAATGGTGG - Intronic
946645660 2:221831199-221831221 AAAATCTATGATTCCAAAGCAGG + Intergenic
946804407 2:223456412-223456434 ATTATTTTTAATAGCAAAGGTGG + Intergenic
947941990 2:234064972-234064994 ATTATCTATGATAGCCAAAAAGG - Intronic
1170158543 20:13290043-13290065 AATGTGTATGTTAGCAAAAGGGG + Intronic
1174929499 20:54797198-54797220 AATATCTTTCATAAAAAAGGTGG - Intergenic
1177369613 21:20184648-20184670 AATATCTTTGATTACCAAGGTGG - Intergenic
1181641558 22:24202895-24202917 ATTATCCATGCTAGCAAGGGAGG - Intergenic
1182163162 22:28144156-28144178 AATCTCTAGGATAGCAATGAAGG - Intronic
949291023 3:2465714-2465736 AATAATTAGGATAGCAAAGCAGG + Intronic
949707723 3:6838175-6838197 ATTATCTTTGATAGAAATGGAGG - Intronic
950767395 3:15283412-15283434 AATATCTAAGATTGCCAATGAGG + Intronic
952809555 3:37389054-37389076 CATTTCTATGAAAGCAATGGGGG - Intronic
953203316 3:40797555-40797577 AATATCTATGAGAGAAAATGTGG - Intergenic
955053415 3:55434112-55434134 CATATTTATTATAGAAAAGGTGG + Intergenic
955868128 3:63407616-63407638 AATATATATGATTACAAAGAAGG - Intronic
957432314 3:80126682-80126704 TATAACTATGATAGTAAACGAGG - Intergenic
960045730 3:113195934-113195956 AATATCCATGACAGCGAATGAGG + Intergenic
962183815 3:133236987-133237009 AATATCTCTGACAGCTAAGGAGG - Intronic
962654416 3:137528598-137528620 GATATCTAAGCTGGCAAAGGAGG - Intergenic
967383868 3:188890794-188890816 AATATCTCTCATAGCAAATATGG + Intergenic
967618490 3:191603135-191603157 AATATCTATAGGAGTAAAGGAGG + Intergenic
967933071 3:194704645-194704667 AATAATAATAATAGCAAAGGTGG + Intergenic
968241425 3:197090507-197090529 AATTTCCATAGTAGCAAAGGAGG - Intronic
970114190 4:12675140-12675162 AGAGTCTATGAAAGCAAAGGTGG - Intergenic
970828210 4:20304101-20304123 TTTAGCTATGATAGCAGAGGAGG + Intronic
971877576 4:32325386-32325408 GATAACAGTGATAGCAAAGGGGG - Intergenic
972284567 4:37635900-37635922 AATCTCCATTATATCAAAGGAGG + Intronic
972713496 4:41622493-41622515 AGTATCTAAAACAGCAAAGGGGG + Intronic
973911570 4:55586840-55586862 AATGTTTATGATAGAAAAGATGG - Intronic
974363080 4:60908451-60908473 AGTATATATAATAGCAAATGTGG + Intergenic
977336333 4:95704494-95704516 ACAATCTATGCTAGCAAAGCAGG + Intergenic
979014156 4:115411266-115411288 AATATTTATGATGGCAATGATGG + Intergenic
979151370 4:117320340-117320362 AGTCTCTATTATAGGAAAGGAGG + Intergenic
980389701 4:132127073-132127095 TAAATCTATGATATCAAAGGGGG + Intergenic
984746997 4:183231141-183231163 ATTATATATAATAGCTAAGGTGG + Intronic
984913918 4:184702995-184703017 ATTATCCATGATAGTAAAGACGG - Intronic
986394497 5:7315041-7315063 AATCTCTAGGCTAGCAAAGGAGG + Intergenic
986621795 5:9683551-9683573 AAGATCTATGTTAGCAACAGAGG + Intronic
987021984 5:13883706-13883728 AATATCTGTAATAGAAAAGCTGG + Intronic
988897642 5:35695023-35695045 AATAATAATGATAGCACAGGAGG - Intronic
990244211 5:53847550-53847572 AATATCAATGAAACCAAAGCTGG + Intergenic
991055065 5:62311215-62311237 AAGAACTATGACAGTAAAGGAGG + Intronic
992637912 5:78742969-78742991 AATATCAATGAAAACAAAGTGGG + Intronic
994203650 5:97008026-97008048 CATATCTTTGATAGCATAGCTGG + Intronic
996217344 5:120886367-120886389 AATACCAATGAGAGCAATGGTGG + Intergenic
996436481 5:123438715-123438737 AATATTAATGATAGCACAGGTGG - Intergenic
996505574 5:124264383-124264405 AATATCTTTGTTTGCAAAGGGGG + Intergenic
997673481 5:135695349-135695371 AAGATCTATGAGAGCAAATCTGG + Intergenic
1000444470 5:161302846-161302868 AAATTCTATGAGAGCAAGGGAGG + Intronic
1000759097 5:165199100-165199122 AATACCTGTGTTAACAAAGGAGG - Intergenic
1002026872 5:176401710-176401732 AAAATCCAAGAAAGCAAAGGAGG - Intronic
1004862425 6:19818664-19818686 AATATCTATGATTGCAAACTTGG - Intergenic
1005128056 6:22471327-22471349 AATAACAATGATAGCCATGGAGG - Intergenic
1005216993 6:23541944-23541966 AATATGTATGCTAGGAAAGGAGG - Intergenic
1007508133 6:42353199-42353221 AATATCTAGAAAATCAAAGGGGG - Intronic
1010014543 6:71089351-71089373 AATATTGAGGAAAGCAAAGGAGG - Intergenic
1010144669 6:72653316-72653338 AAAATCTATTAAAACAAAGGAGG - Intronic
1010568390 6:77447210-77447232 AGTATCAATGGAAGCAAAGGGGG - Intergenic
1010721849 6:79291662-79291684 AACATCTATGTTAGAAAAGAAGG + Intergenic
1011124900 6:83996463-83996485 AATATCTAGGAGAGTAATGGTGG - Intergenic
1013649575 6:112180950-112180972 AATATCTGTGATGGCACAGAGGG - Intronic
1013746837 6:113355756-113355778 AATTTCTATGAGAACAAAAGTGG + Intergenic
1014879512 6:126705612-126705634 AATATCTGAGATAGAAAAAGTGG - Intergenic
1015511708 6:134044161-134044183 AATATCTATGATAGCAAAGGGGG - Intronic
1017585496 6:155917742-155917764 AATATTTATAATAACAAAGGAGG + Intergenic
1020848596 7:13319967-13319989 AATAATCATCATAGCAAAGGAGG - Intergenic
1021952600 7:25789900-25789922 AATGTCTATGGGAACAAAGGAGG - Intergenic
1022780884 7:33582113-33582135 AATATCTATTACAGCAAAGAGGG - Intronic
1028534133 7:91872608-91872630 AGTATCACTGATAGCAAATGAGG + Intronic
1029011363 7:97265054-97265076 AATATATATGATGGAAAAAGAGG + Intergenic
1030345197 7:108425286-108425308 AATATCTATGAAATAAAAGTTGG - Intronic
1031148960 7:118030376-118030398 AATATTTATGGTAGCAAAAGGGG - Intergenic
1031791591 7:126112837-126112859 AATATCAGTGATGGCAAAGAAGG + Intergenic
1038076757 8:24084483-24084505 AGAAGCTATGCTAGCAAAGGTGG + Intergenic
1039337670 8:36610728-36610750 AATGTCTAAGATATCAAAGATGG - Intergenic
1041163600 8:55070007-55070029 AATATCTTTGATAATAATGGTGG - Intergenic
1042085765 8:65107015-65107037 AATATACAGGATATCAAAGGAGG + Intergenic
1042344642 8:67715063-67715085 AATATTTCTGACAGCAAATGTGG + Intronic
1042494118 8:69436818-69436840 AATAACAATAATAACAAAGGTGG + Intergenic
1042504746 8:69548280-69548302 ATGATCACTGATAGCAAAGGAGG + Intronic
1042853923 8:73245404-73245426 AATGTCTATGTTAGAAAAGAAGG + Intronic
1044010751 8:86991462-86991484 AATATCAATGAAACCAAGGGTGG - Intronic
1044139437 8:88631583-88631605 TATATCTATGATTTAAAAGGTGG - Intergenic
1044545333 8:93452939-93452961 ATTGTCTATGATAACAAATGAGG - Intergenic
1048326000 8:133439689-133439711 AATAGCTATAATAGAAAAGATGG - Intergenic
1048505864 8:135020896-135020918 AATATCTTTGAAGGCAAAGTAGG - Intergenic
1052113853 9:24624631-24624653 AATCTCTGTAATAGCAAGGGTGG - Intergenic
1052608311 9:30733550-30733572 AATGTCTGTGATAGCCAAGAAGG - Intergenic
1052799469 9:32954733-32954755 AATATCACTAATAGCAAAGGTGG - Intergenic
1055713847 9:79095590-79095612 AATATCTATCATAGCAATGTGGG + Intergenic
1055897292 9:81192950-81192972 AATATCTACAGTAGTAAAGGTGG + Intergenic
1056070183 9:82978284-82978306 AATCTAAATGATAGCAAAAGTGG - Intergenic
1056716949 9:89039516-89039538 GATGTAGATGATAGCAAAGGTGG - Intronic
1058828696 9:108796601-108796623 ATTGTCTCTGATAGGAAAGGAGG - Intergenic
1059292954 9:113243810-113243832 AATATCTATTTTAGCAAAAAGGG - Intronic
1185989180 X:4873660-4873682 AATATTTGTGATGGCAGAGGGGG - Intergenic
1186790807 X:12996563-12996585 AATATCTATAAAATCAAAGGTGG - Intergenic
1187582208 X:20620199-20620221 AATATCTATGATGTAAAAGAAGG + Intergenic
1187807659 X:23138595-23138617 AATAACGATGGTAGCAAGGGAGG + Intergenic
1188837249 X:34973675-34973697 GATATCTATGAGAGGAAAGCTGG + Intergenic
1189102685 X:38207581-38207603 AAAATCTAAGAAAGGAAAGGAGG + Intronic
1189682299 X:43529254-43529276 AATATCTATGAAGGAAAGGGAGG - Intergenic
1193336671 X:80298000-80298022 AATATAAATAATAGCAAAGGGGG + Intergenic
1194112858 X:89856312-89856334 AATGTCTATAATACCAAAAGAGG + Intergenic
1196699459 X:118652109-118652131 AACTTCCCTGATAGCAAAGGTGG - Intronic
1198440020 X:136654048-136654070 AATATCTGTCAAAGCCAAGGAGG + Intronic
1198834780 X:140793558-140793580 AACATCAATGAAAGTAAAGGAGG - Intergenic
1200465511 Y:3511125-3511147 AATGTCTATAATACCAAAAGAGG + Intergenic
1200952106 Y:8908176-8908198 AATATCTATGATATGCAATGTGG - Intergenic
1200961461 Y:9000140-9000162 ATGAGCTATGATAGCAATGGTGG + Intergenic
1200982431 Y:9274332-9274354 ATGAGCTATGATAGCAATGGTGG - Intergenic
1201867588 Y:18671723-18671745 ACTAGCTATGATAGCAATGGTGG + Intergenic
1202127972 Y:21585397-21585419 ATGAGCTATGATAGCAATGGTGG + Intergenic
1202151320 Y:21846101-21846123 ATGAGCTATGATAGCAATGGTGG - Intergenic