ID: 1015513756

View in Genome Browser
Species Human (GRCh38)
Location 6:134064682-134064704
Sequence GTGAATACCCTTCCATGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015513756_1015513760 -2 Left 1015513756 6:134064682-134064704 CCTGGACATGGAAGGGTATTCAC No data
Right 1015513760 6:134064703-134064725 ACTCGGGGAAGAAATTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015513756 Original CRISPR GTGAATACCCTTCCATGTCC AGG (reversed) Intergenic
No off target data available for this crispr