ID: 1015516081

View in Genome Browser
Species Human (GRCh38)
Location 6:134083807-134083829
Sequence AGGGGATCCCATCAGTATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015516074_1015516081 16 Left 1015516074 6:134083768-134083790 CCATCTGGAAGGAATCCTACATA No data
Right 1015516081 6:134083807-134083829 AGGGGATCCCATCAGTATCAGGG No data
1015516076_1015516081 1 Left 1015516076 6:134083783-134083805 CCTACATAGGAGAGCAGCTGAGT No data
Right 1015516081 6:134083807-134083829 AGGGGATCCCATCAGTATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015516081 Original CRISPR AGGGGATCCCATCAGTATCA GGG Intergenic
No off target data available for this crispr