ID: 1015516084

View in Genome Browser
Species Human (GRCh38)
Location 6:134083814-134083836
Sequence TCCCTTGCCCTGATACTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015516084_1015516090 3 Left 1015516084 6:134083814-134083836 CCCATCAGTATCAGGGCAAGGGA No data
Right 1015516090 6:134083840-134083862 AGGGTCAGGTGCTGAAGGTGAGG No data
1015516084_1015516089 -2 Left 1015516084 6:134083814-134083836 CCCATCAGTATCAGGGCAAGGGA No data
Right 1015516089 6:134083835-134083857 GAACAAGGGTCAGGTGCTGAAGG No data
1015516084_1015516091 4 Left 1015516084 6:134083814-134083836 CCCATCAGTATCAGGGCAAGGGA No data
Right 1015516091 6:134083841-134083863 GGGTCAGGTGCTGAAGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015516084 Original CRISPR TCCCTTGCCCTGATACTGAT GGG (reversed) Intergenic
No off target data available for this crispr