ID: 1015518256

View in Genome Browser
Species Human (GRCh38)
Location 6:134106105-134106127
Sequence CCTGACAAGCTGGTATAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015518256_1015518259 8 Left 1015518256 6:134106105-134106127 CCATGCTATACCAGCTTGTCAGG No data
Right 1015518259 6:134106136-134106158 CACAAACATCAAGATAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015518256 Original CRISPR CCTGACAAGCTGGTATAGCA TGG (reversed) Intergenic
No off target data available for this crispr