ID: 1015518259

View in Genome Browser
Species Human (GRCh38)
Location 6:134106136-134106158
Sequence CACAAACATCAAGATAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015518256_1015518259 8 Left 1015518256 6:134106105-134106127 CCATGCTATACCAGCTTGTCAGG No data
Right 1015518259 6:134106136-134106158 CACAAACATCAAGATAGATAAGG No data
1015518258_1015518259 -2 Left 1015518258 6:134106115-134106137 CCAGCTTGTCAGGTTGCTTTGCA No data
Right 1015518259 6:134106136-134106158 CACAAACATCAAGATAGATAAGG No data
1015518255_1015518259 22 Left 1015518255 6:134106091-134106113 CCTAGAGCAGTGGACCATGCTAT No data
Right 1015518259 6:134106136-134106158 CACAAACATCAAGATAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015518259 Original CRISPR CACAAACATCAAGATAGATA AGG Intergenic
No off target data available for this crispr