ID: 1015519124

View in Genome Browser
Species Human (GRCh38)
Location 6:134114122-134114144
Sequence ATGCTGCAGCAGAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 666
Summary {0: 2, 1: 5, 2: 7, 3: 79, 4: 573}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015519124_1015519128 -10 Left 1015519124 6:134114122-134114144 CCCTCCTCACTCTGCTGCAGCAT 0: 2
1: 5
2: 7
3: 79
4: 573
Right 1015519128 6:134114135-134114157 GCTGCAGCATCCTAGAGACAGGG No data
1015519124_1015519133 12 Left 1015519124 6:134114122-134114144 CCCTCCTCACTCTGCTGCAGCAT 0: 2
1: 5
2: 7
3: 79
4: 573
Right 1015519133 6:134114157-134114179 GCCCTATCTTCCCTGGGACTGGG No data
1015519124_1015519131 6 Left 1015519124 6:134114122-134114144 CCCTCCTCACTCTGCTGCAGCAT 0: 2
1: 5
2: 7
3: 79
4: 573
Right 1015519131 6:134114151-134114173 GACAGGGCCCTATCTTCCCTGGG No data
1015519124_1015519132 11 Left 1015519124 6:134114122-134114144 CCCTCCTCACTCTGCTGCAGCAT 0: 2
1: 5
2: 7
3: 79
4: 573
Right 1015519132 6:134114156-134114178 GGCCCTATCTTCCCTGGGACTGG No data
1015519124_1015519130 5 Left 1015519124 6:134114122-134114144 CCCTCCTCACTCTGCTGCAGCAT 0: 2
1: 5
2: 7
3: 79
4: 573
Right 1015519130 6:134114150-134114172 AGACAGGGCCCTATCTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015519124 Original CRISPR ATGCTGCAGCAGAGTGAGGA GGG (reversed) Intergenic
900495306 1:2973414-2973436 GTGCTGGGGCAGAGGGAGGAGGG + Intergenic
900728886 1:4238481-4238503 TTGCTGCCGCCAAGTGAGGAAGG - Intergenic
901492305 1:9602751-9602773 ACCGTGCAGCAGAGTGAGGCTGG + Intronic
901862136 1:12081214-12081236 AGGCCCCAGCAGAGTGAGCAGGG + Intronic
902109238 1:14064426-14064448 AGGCTGCAGCAGAGTGACCTGGG - Intergenic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902250426 1:15151521-15151543 AGTCTGCAGCAGAGTGGGGCGGG + Intergenic
902378319 1:16040746-16040768 ATGCCGCAGCAGAGAGAGCAAGG - Intergenic
902470003 1:16642725-16642747 CTGGCCCAGCAGAGTGAGGAGGG + Intergenic
902546025 1:17190824-17190846 GTGTAGCAGCAGCGTGAGGAAGG - Intergenic
903024163 1:20415413-20415435 TGGCTGCAGCAGAGTGACCAAGG + Intergenic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903296045 1:22343675-22343697 TGGCTGCAGCAGAGTGGGCAAGG + Intergenic
903731192 1:25496745-25496767 ATGGTCCAGCAGAGAGACGATGG + Intronic
903815285 1:26060284-26060306 ATCCTCCAGCTGAGTGATGATGG + Exonic
904421608 1:30398054-30398076 AGGCTGCAGCAGGATGAGGAGGG + Intergenic
905106528 1:35566342-35566364 GTGTTGCAGCAGAGTGACGATGG + Exonic
905227808 1:36491305-36491327 ATGAGGCTGCAGGGTGAGGAAGG - Intergenic
905820624 1:40987565-40987587 ATACTGCACCAGAGATAGGAAGG - Intronic
906071939 1:43023245-43023267 ATGCTGCAGATGAGTGATTAAGG + Intergenic
906188364 1:43879238-43879260 ATGCTGTAACAGGGTGAGGAAGG + Intronic
906283253 1:44568277-44568299 TGGCTGGAGCAGAGTGAGGTGGG - Intronic
906545819 1:46618706-46618728 AGGCTGCAGGAGTGTGGGGAAGG + Intergenic
906657062 1:47556036-47556058 AGGCTTCAGCAGAGTCAGGGCGG - Intergenic
907184311 1:52598120-52598142 TGGCTGGAGCAGAGTGAGCAAGG - Intergenic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907534740 1:55140720-55140742 GGGCAGCAGCAGAGTGAGGTAGG + Intronic
907857812 1:58321247-58321269 CTGCTGCAGCATAAAGAGGAAGG - Intronic
907869157 1:58427216-58427238 GAGATGCAGTAGAGTGAGGAGGG + Intronic
908788855 1:67761380-67761402 ATGCTACAGCTGAGTGAGGTTGG - Intronic
909393013 1:75136792-75136814 CTCCTGCAGCAGACAGAGGACGG + Intronic
909692391 1:78423417-78423439 AAGCTTGAGCAAAGTGAGGAAGG - Intronic
910292310 1:85611498-85611520 AAGTTACATCAGAGTGAGGAGGG + Intergenic
910732705 1:90415503-90415525 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
911099000 1:94079107-94079129 AGGCTGCAGTAGAGAGGGGAGGG + Intronic
911407626 1:97462647-97462669 ATGCTGTACTAGAGTGAGGCTGG - Intronic
912704510 1:111902075-111902097 CTGCTGCACCTGAGTGAGGCCGG - Intronic
912738664 1:112173683-112173705 CTGCTGAAGCAGAGTGGGAAAGG - Intergenic
912777869 1:112517377-112517399 AGGCTGCAGGTGAGTAAGGAAGG + Exonic
912863103 1:113232507-113232529 ATCCTGCAGCTGGATGAGGAGGG - Intergenic
913007808 1:114651959-114651981 GAGCTTCAGCAGAATGAGGAGGG + Intronic
913318754 1:117574377-117574399 AAGCTGCAGGAGAAGGAGGATGG - Intergenic
914346714 1:146806316-146806338 ATGGTGCTGCAGGGTCAGGAAGG - Intergenic
916944185 1:169708373-169708395 ATGCTGCCTCAGACTCAGGAAGG - Intronic
917048331 1:170888972-170888994 AGGCTGTAGCATAGTGAGGATGG - Intergenic
917180391 1:172290466-172290488 TGGCTGGAGCAGAATGAGGATGG + Intronic
917475228 1:175363570-175363592 ATGCTGCATCAGAATGAGAGTGG - Intronic
917842991 1:178997494-178997516 ATGATTAAGCATAGTGAGGAAGG - Intergenic
918237207 1:182592201-182592223 AGGCTGGAGCAGAGTGAGGGAGG + Intergenic
918462386 1:184789874-184789896 ATGCTGCAGTAGAGTGAGAGAGG + Intergenic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
918618027 1:186570649-186570671 ATGCTGCAGGAGATAGAGAAAGG - Intergenic
920258176 1:204670799-204670821 CTGCTTCAGCAGAGTGATGGGGG + Intronic
920460603 1:206136673-206136695 TTGCTGGTGCAGAGTGGGGATGG + Intergenic
921164857 1:212499648-212499670 TGGCTGGAGCAGAGTGAGCAGGG + Intergenic
921202350 1:212819397-212819419 ATGCTGCGGCAGTGTGGCGAGGG - Intergenic
921329666 1:214022947-214022969 AAGCTGCAGCAGAGTCACCAGGG - Intronic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
922496028 1:226058641-226058663 AGTCTGCAGCACAGTGCGGAGGG + Intergenic
922794658 1:228334143-228334165 AAGCTGCAGCAGTGGCAGGACGG - Intronic
922914321 1:229243325-229243347 ATGCTTTGGCAGAGAGAGGAAGG + Intergenic
923067102 1:230527919-230527941 ATGCTATAGCAGAGTCAGGTTGG + Intergenic
923293285 1:232568241-232568263 ATGAAGCAGCAGAGAAAGGAAGG + Intergenic
923387100 1:233475772-233475794 ATGCTATAGCAGAGTCAGGTTGG + Intergenic
923514204 1:234680961-234680983 AAGCTGCAGGGGAGTGAGCAAGG + Intergenic
923887639 1:238176906-238176928 ATGCTGCAGAAGAGTGCAGTGGG - Intergenic
924351153 1:243115735-243115757 AAGCTGCAGCAGAGTGTGCCTGG - Intergenic
924878723 1:248134728-248134750 ATGTTGAAGCATAGTAAGGAAGG + Intergenic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1064002031 10:11671767-11671789 ATGATGAAGCGTAGTGAGGAAGG - Intergenic
1064819834 10:19316364-19316386 ATACTGCAGCAGAGTGGAGAGGG + Intronic
1065839016 10:29684852-29684874 ATGCTACAGTAGAGTCAGGTTGG + Intronic
1066139554 10:32489718-32489740 AGGCTGGTGCAGAGTGAGCATGG + Intronic
1066442211 10:35449622-35449644 ATGATGCAGGAGAGAGAGGGTGG + Intronic
1067064722 10:43097297-43097319 AGGCTGCAGAAGAGTGGGTAGGG - Intronic
1068369755 10:56096726-56096748 AGGCAGCAACAGAGTGAGGGAGG + Intergenic
1069160202 10:65083755-65083777 GGGCTGTAGCAGAGTGAGCAGGG + Intergenic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1069736401 10:70657853-70657875 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1070217185 10:74397427-74397449 ATTCTGGAGCAGTATGAGGAAGG + Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070311172 10:75275278-75275300 ATGCTGCAGCAGAGTGACAAAGG - Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071982914 10:91021915-91021937 ATGCTGAGGCTGAGTGAAGAAGG - Intergenic
1072317356 10:94215676-94215698 AGCCAGCAGCAGAGAGAGGATGG + Intronic
1072833013 10:98679228-98679250 CTGCTGATGTAGAGTGAGGATGG - Intronic
1073322890 10:102626289-102626311 ATGGCCCAGCAGATTGAGGAAGG + Intronic
1073594795 10:104789032-104789054 ATTCTTCAGCAGGGTGAGGGGGG + Intronic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1074798364 10:116972629-116972651 ATGGTGCAGCTGCGTGAGCAGGG - Intronic
1075530336 10:123223673-123223695 AGGGTGCAGCTGAGAGAGGAAGG - Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076553980 10:131310583-131310605 ATGGTGCAGCAGAGCTAGGCGGG - Intronic
1076839114 10:133036909-133036931 AGGCTGCACCAGAGTCAGGCTGG - Intergenic
1077542941 11:3156051-3156073 ATGCTGAGGCAGAGTAAGGGTGG + Intronic
1077784684 11:5370321-5370343 ATGCTACAGCAAAGTGAGATAGG + Intronic
1078860681 11:15243553-15243575 AGGCTGCTGCACACTGAGGAGGG + Intronic
1078885546 11:15496405-15496427 GTGGTGCAGTAGAGTGAGGAAGG - Intergenic
1079003221 11:16774745-16774767 AGGTTGGAGCAGGGTGAGGAAGG - Intergenic
1081085993 11:38802092-38802114 ATGTTGAAGCAGAGTGAGTTTGG + Intergenic
1081468328 11:43345898-43345920 TGGCTGCAGCAGAGTGATCAAGG - Intergenic
1081607418 11:44536093-44536115 ATGATGCAGAAGAGGGAGGAGGG + Intergenic
1082971657 11:59029187-59029209 ATGATTAAGCATAGTGAGGAAGG - Intronic
1083275055 11:61592188-61592210 GGGCTGGAGCAGAGGGAGGATGG + Intergenic
1083318806 11:61832684-61832706 TTTCTGCAGCAGAGAGAGGCAGG - Intronic
1085413156 11:76303513-76303535 CTGCTGCAGCCGAGTGAGACAGG + Intergenic
1085446815 11:76606298-76606320 TTGCAGCAGAAGAGTGAGAAGGG - Intergenic
1085506701 11:77064939-77064961 ATGCTGCAGCACAGGGAGGAAGG + Intergenic
1085803351 11:79611780-79611802 ATGCTGAGGCAGAGTGTGGGAGG + Intergenic
1086291586 11:85316543-85316565 ATGATGCAGCAGAATAAAGAAGG + Intronic
1086357905 11:86024610-86024632 ATAATGCAGTAGAGAGAGGAGGG - Intronic
1087141907 11:94772374-94772396 ATTTAGCAACAGAGTGAGGATGG - Intronic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1088626140 11:111732027-111732049 AGGCTCCAGCAGGGTGGGGAAGG + Intronic
1089233851 11:117005796-117005818 ATGCTTCAGCAGAAAGAGGCAGG + Intronic
1089493932 11:118899213-118899235 CTGCTGCAGCCGAGGGGGGAAGG + Exonic
1089572655 11:119420553-119420575 AGGCTCAAGCAGAGTGGGGAGGG - Intronic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1091206789 11:133827036-133827058 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1091705962 12:2693551-2693573 AGGCTGCTCCAGAGTGAGGAAGG - Intronic
1092836456 12:12493610-12493632 TGGCTGGAGCAGAGTGAGCATGG - Intronic
1094205369 12:27834026-27834048 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1095349264 12:41189201-41189223 TTCCTGCTGCATAGTGAGGAAGG - Intronic
1095657846 12:44691566-44691588 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1096526206 12:52211831-52211853 ATGCTCCTGCAGAGGGAGGAGGG + Intergenic
1096979794 12:55721815-55721837 TTGCTGCAGCAGAGGCAGCAGGG - Exonic
1097695061 12:62767617-62767639 AGTCTGGAGAAGAGTGAGGATGG + Intronic
1098249158 12:68550842-68550864 TGGCTGGAGCACAGTGAGGAAGG - Intergenic
1098879604 12:75903623-75903645 ATCCTGATGCTGAGTGAGGAGGG + Intergenic
1098936947 12:76490882-76490904 ATGCTGCAGCAGAGCCTGCACGG + Intronic
1099044788 12:77703866-77703888 ATGCTGCAGAAGTGAGAAGATGG + Intergenic
1099541034 12:83907907-83907929 TGGCTGGAGCAGAGTGAGGTGGG + Intergenic
1100237645 12:92677103-92677125 ATCCTGCAGCAAAGTGGGCAAGG - Intergenic
1100406934 12:94280146-94280168 ATGCTGCTGCACACTGAGGGAGG - Exonic
1100461458 12:94804014-94804036 ATTCTGGAGCAGAGAGAGAATGG - Intergenic
1100702306 12:97161470-97161492 GGGCTGAAGCAGGGTGAGGAGGG + Intergenic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101441026 12:104704360-104704382 AGGCTGCAGGTGAGGGAGGAAGG + Intronic
1101535555 12:105613147-105613169 AGGCAGCAGGAGAGAGAGGAAGG - Intergenic
1101679287 12:106949192-106949214 CTTCTGCAGCAGGGAGAGGAGGG - Intergenic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102308734 12:111827120-111827142 ATGCTGCACCTGAGTGAGGCTGG + Intergenic
1102504440 12:113374783-113374805 GAGCTGCAGCAGGCTGAGGAGGG - Exonic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1103932562 12:124458306-124458328 GGGCTGCAGCAGAGAGAGGAGGG + Intronic
1104239963 12:126978901-126978923 ACGCTGCAGCCGAGTGCAGAGGG + Intergenic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1104588115 12:130063618-130063640 TTGCTGCAGCCGTGTGAAGAAGG + Intergenic
1105705678 13:22966221-22966243 GTGCTGCAGCAGAGGGAGTGGGG + Intergenic
1105723171 13:23135712-23135734 ATGCTGCAGCAGAATAAACAAGG + Intergenic
1105858581 13:24391206-24391228 GTGCTGCAGCAGAGGGAGTGGGG + Intergenic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106370744 13:29130336-29130358 TGGCTTGAGCAGAGTGAGGAGGG - Intronic
1106701043 13:32228915-32228937 ATGATGCAGCAGATGGAGGCAGG + Intronic
1106833921 13:33613797-33613819 ATTTAGCAGCAGGGTGAGGAAGG + Intergenic
1107015683 13:35706405-35706427 AGGCTGCAGGAGAGAGAAGAGGG + Intergenic
1107459078 13:40583915-40583937 ATGATTCAGCTTAGTGAGGAAGG - Intronic
1107761800 13:43687606-43687628 AAGTTGCAGGAGAGAGAGGAGGG + Intronic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1110692023 13:78442068-78442090 CTGCTCCAGCTGAATGAGGATGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111588009 13:90307455-90307477 ATACTACAGCAGTGTGAGAATGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1111934581 13:94546315-94546337 GGGCTTCAGCAGAGTCAGGAAGG - Intergenic
1112748342 13:102553073-102553095 ATGGTCCAGCAGAGAGAAGACGG - Intergenic
1113272309 13:108686808-108686830 ATGCCGCAGCAGTGGGAAGAGGG + Intronic
1113587591 13:111475953-111475975 GCTCTGCAGAAGAGTGAGGAGGG + Intergenic
1114781291 14:25540955-25540977 ATGCTGAAAAGGAGTGAGGATGG + Intergenic
1114788016 14:25623331-25623353 CTTCTGCAGCAAAGGGAGGAAGG + Intergenic
1114804319 14:25816942-25816964 ATGCTACAACAGAGGGAAGAGGG + Intergenic
1115152711 14:30303744-30303766 ATGCTGCAGGAGAATGAGAGTGG - Intergenic
1115427529 14:33277744-33277766 TTGCTGGAGCAGAATGAGAAAGG + Intronic
1116321595 14:43473057-43473079 ATGCTGCGGAAGACCGAGGAAGG + Intergenic
1116655742 14:47651449-47651471 ATGAGGCAGCAGAGTGGGCAGGG + Intronic
1116986734 14:51227854-51227876 TGGATGGAGCAGAGTGAGGAAGG + Intergenic
1117552592 14:56851036-56851058 ATGATGCAGGAGAGAGGGGAGGG + Intergenic
1118072234 14:62257702-62257724 ATGATGCAGCAGAGGGAGGCAGG + Intergenic
1118225824 14:63898255-63898277 GTGATGCAGCAGATTGAGGCAGG - Intronic
1118742837 14:68753028-68753050 ACCCTGAAGCAGAGTGAGGCTGG - Intergenic
1119365023 14:74084333-74084355 ATCCTGCAGGCGAGTGAGGGTGG - Exonic
1119733354 14:76965195-76965217 ACTCTGCAGCGGGGTGAGGAAGG - Intergenic
1120857534 14:89225685-89225707 ATGCTTCAGGACAGTGAGGGAGG - Intronic
1121534029 14:94678788-94678810 GTGCTGCAGCTGAGTGAGTCTGG + Intergenic
1122339421 14:101018673-101018695 ATGCCACAGCATGGTGAGGAAGG - Intergenic
1122492852 14:102131510-102131532 TGGCTGGAGCAGAGTGAGCAGGG - Intronic
1122735740 14:103839744-103839766 TGGCTGGAGCAGAGTGAGTAAGG - Intronic
1123685616 15:22795022-22795044 AGGGAGCCGCAGAGTGAGGATGG + Intronic
1123978005 15:25570801-25570823 ATGCTGCAGGAAAGTTAGGAAGG - Intergenic
1124096326 15:26651756-26651778 ATGCTGTACCAGAGTGAGGTTGG - Intronic
1124208759 15:27744961-27744983 ATGCTGCACTAGAGTCAGGTTGG - Intergenic
1124347430 15:28932018-28932040 ATGCAGCAGCACAGAAAGGAGGG - Intronic
1124662821 15:31563912-31563934 GTGCTCCAGCACAGTGAAGATGG + Intronic
1124781135 15:32635156-32635178 AGACTGGAGCAGAGTGAGCAAGG - Intronic
1125207242 15:37167601-37167623 TTGCTGCAGGAGAGGGAAGATGG - Intergenic
1125870593 15:43098002-43098024 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1126657712 15:50997640-50997662 AGGCTGCAGTAGATTGAGGAGGG - Exonic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1128674592 15:69599409-69599431 ACACTGAAGGAGAGTGAGGAAGG + Intergenic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1128802931 15:70508428-70508450 ATGCTGCAGCAGATTGGGGGTGG - Intergenic
1128871258 15:71156951-71156973 ATGATGCAGCAGAGTAAGCAGGG - Intronic
1129477274 15:75794603-75794625 CTGTTGCAGCAGAGTGAGGGTGG - Intergenic
1130298070 15:82661103-82661125 ATTCTGCAGAAGAAAGAGGAGGG - Intronic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131674077 15:94653446-94653468 ATACTGCAGCAGAAGGAGCATGG - Intergenic
1133772994 16:8878480-8878502 CTGCTGAGCCAGAGTGAGGAAGG + Intergenic
1133871268 16:9688617-9688639 ATGCTGTAGTAGAGTCAGGTTGG - Intergenic
1135510063 16:23074939-23074961 ATGCTGGAACAGACTCAGGATGG + Intronic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1136319042 16:29470684-29470706 ATGATTCCGCAGAATGAGGAGGG - Intergenic
1136433613 16:30210028-30210050 ATGATTCCGCAGAATGAGGAGGG - Intergenic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1138063600 16:53917112-53917134 ATGGGGTAGCAGAGTAAGGATGG - Intronic
1138852151 16:60641965-60641987 ATGAATCAGCAGAGTTAGGAAGG + Intergenic
1139347967 16:66316659-66316681 CTGCTGCTGCAGATTGAGGGAGG + Intergenic
1139521924 16:67488033-67488055 ATGCTGCAGAAGAGTGAGGATGG + Intergenic
1139749827 16:69102865-69102887 ATGTTGCTGCTGAGTGAGGACGG + Intergenic
1139987267 16:70908954-70908976 ATGGTGCTGCAGGGTCAGGAAGG + Intronic
1140777146 16:78260136-78260158 AGGCTGCAGCACAGCAAGGATGG - Intronic
1142211256 16:88809704-88809726 ATACTGCAGGAGAGAGAAGAAGG + Exonic
1142227352 16:88884150-88884172 ATGCTGCAGCCGGGTCAGGCAGG - Intronic
1142653379 17:1372496-1372518 ATGATGAAGCTGAGTCAGGAAGG - Intronic
1143363205 17:6388047-6388069 AGGGTGGAGCAGAGTGAGAAGGG + Intergenic
1143408062 17:6691086-6691108 AGGAGACAGCAGAGTGAGGACGG - Intronic
1143735034 17:8905626-8905648 ATGCTGGAGGTGAGGGAGGAGGG - Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144119083 17:12132772-12132794 ATGCTGCAGAAGAGTGCAGAAGG + Intronic
1144952120 17:19000045-19000067 AGGCTGCAGCCAAGTGAGGCCGG + Intronic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1146210078 17:30935441-30935463 GTGCTGCTGCAGAGTGATCAGGG + Intronic
1146593248 17:34146954-34146976 AGGCTGCAGCAGGATGAGGGAGG - Intronic
1146662676 17:34675028-34675050 CATGTGCAGCAGAGTGAGGAGGG - Intergenic
1148638662 17:49168723-49168745 TTGCTGGAACAGAGTGAGAATGG + Exonic
1148842991 17:50511038-50511060 AACATGCACCAGAGTGAGGAGGG + Intronic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1150997549 17:70336263-70336285 AGGCAGCATCAGAGTGAGGCAGG - Intergenic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1151391918 17:73793119-73793141 AGGCTGCAGCAGAGCTTGGAAGG + Intergenic
1151768584 17:76145167-76145189 AGGCAGCAGCTGAGTGAGGATGG + Exonic
1151949330 17:77341199-77341221 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1153144143 18:2010083-2010105 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1153568862 18:6448106-6448128 CTGCTTCAGCAGAGTGTGGAAGG + Intergenic
1153948680 18:10038874-10038896 ACACTGCAGCAGGGTGAGGTAGG - Intergenic
1154024742 18:10696658-10696680 ATCCTGAGGCAGAGAGAGGAAGG - Intronic
1154472852 18:14721847-14721869 CTGGTGCAGCAGAGAGAGGGAGG + Intergenic
1155294487 18:24372538-24372560 CTGCTGCTGTTGAGTGAGGAGGG - Intronic
1155511911 18:26586547-26586569 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1155933967 18:31735681-31735703 ATGCTGGGGCAGAGTGGGGCTGG + Intergenic
1156450306 18:37262883-37262905 CAGCTGCAGCAGCGTGAGGCAGG + Intronic
1156464860 18:37342440-37342462 ATGCTGCAGCCTGGTGGGGAAGG + Intronic
1157210804 18:45740385-45740407 ACGCTGAATCAGACTGAGGAGGG - Intronic
1157267810 18:46243911-46243933 ATGCTGAAGTAGACTGAGTAAGG + Intronic
1157310198 18:46546948-46546970 GTGCTGCCACAGAGCGAGGAGGG - Exonic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1157714823 18:49876847-49876869 ATGCTGGAGCAGAGGGTGGAGGG - Intronic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1159355361 18:67332952-67332974 ATGCTACACCAGAGTCAGGTTGG + Intergenic
1159388838 18:67761605-67761627 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1159434781 18:68401905-68401927 TTGCTTGAGCAGAGTGAAGAAGG + Intergenic
1160104894 18:75964855-75964877 ATCCTGAACCAGAGTGAGCAGGG + Intergenic
1160676319 19:393277-393299 TGGCTGCAGCAGACTGAGTAAGG + Intergenic
1160695974 19:484728-484750 TGGCTGCCGCAGGGTGAGGAGGG + Intergenic
1160699545 19:499146-499168 TGGCTGCAGCAGAATGAGGAGGG - Intronic
1160751762 19:737766-737788 TGGCTGGAGCAGCGTGAGGAGGG + Intronic
1161063617 19:2227197-2227219 CTGCTGCAAGAGAGTGCGGAAGG - Intronic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257297 19:3316485-3316507 TGGCTGGACCAGAGTGAGGAGGG + Intergenic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161274904 19:3410509-3410531 TGGCTAGAGCAGAGTGAGGAAGG + Intronic
1161283376 19:3457268-3457290 CGGCTGCAGCTGAGTGAGCATGG + Intronic
1161345446 19:3766859-3766881 TGGCTGGAGCACAGTGAGGAGGG + Intronic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161422021 19:4181171-4181193 TGGCTGGAGCAGAGTGAGGCAGG - Intronic
1161427280 19:4210476-4210498 TGGCTGCAGCAGGGTGGGGAGGG - Intronic
1161480139 19:4506234-4506256 AGGCTGGAGCCGAGTGAGGAGGG - Intronic
1161493730 19:4576337-4576359 TGGCTGCAGCAGAGTGTGGAGGG - Intergenic
1161599168 19:5170422-5170444 TGGCTGCAGCAGAGTGAGCCAGG + Intronic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161625400 19:5323636-5323658 TGGCTGGAACAGAGTGAGGACGG + Intronic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161644512 19:5444743-5444765 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161684804 19:5697487-5697509 AGGCTGAGGCAGAGGGAGGAGGG + Intronic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161765033 19:6202799-6202821 TGGCTGGAGCAGAGTGAGGGAGG + Intergenic
1161806520 19:6446629-6446651 ATGCTGCACCAGAGAGATGAGGG - Intronic
1161815691 19:6498543-6498565 CGGCTGAAGCAGAGTGAGGGAGG - Intronic
1161883456 19:6974334-6974356 TTGCTTCACCACAGTGAGGATGG - Intergenic
1162418142 19:10550587-10550609 TGGCTGCAGCAGAGTGTGGGAGG - Intronic
1162543001 19:11309410-11309432 GTGCTGGAACAGAGTGAGCAAGG - Intronic
1162589807 19:11584115-11584137 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
1163166393 19:15500917-15500939 AAGCTGCAGCAGAGTGAGTGAGG - Intergenic
1164534538 19:29075472-29075494 CTGCTCTAGCAGAGGGAGGAGGG + Intergenic
1164585449 19:29469194-29469216 ATGCTGCATAAGAGAGATGAAGG - Intergenic
1165895574 19:39139113-39139135 GTGCTGCAGGAAAGTGGGGAGGG - Intronic
1166099909 19:40565733-40565755 TGGCTGCAGCAGAGTGAGTGGGG + Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166891550 19:45997066-45997088 TGGCTGCAGCAGAGTGAGCCAGG - Intronic
1167000202 19:46741324-46741346 ATGAGGCAGCAGAGGGATGAAGG - Intronic
1167213062 19:48145653-48145675 ATGAGGCAGCAGAGTGTGGTGGG + Intronic
1167427443 19:49436748-49436770 ACGCTGGAGCTGAGTGCGGATGG - Exonic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
925032972 2:665794-665816 ATGCTGCATCTGAGTGAGTGGGG - Intergenic
925112324 2:1346957-1346979 ATGCTGTACCAGAGTCAGGGTGG + Intronic
925153024 2:1629034-1629056 ATGATTCAGCTTAGTGAGGAAGG + Intergenic
925234616 2:2267018-2267040 GTGCTTCAGCACAGGGAGGATGG + Intronic
925326445 2:3025660-3025682 ATTCTGAACCAGAGTGAGGTTGG - Intergenic
926231583 2:11008234-11008256 GAGCTGCAGCAGAAGGAGGAAGG - Intergenic
927205650 2:20608723-20608745 TTGGGGCAGCAGAGTGAGCAAGG - Intronic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
927862398 2:26568293-26568315 ATACTGCAGCAGAGAAAGGCAGG - Intronic
929062901 2:37941738-37941760 ATGCTCCAGCATGGTGGGGAAGG - Intronic
929481747 2:42314751-42314773 AGGCTGCATAAGAGAGAGGATGG - Intronic
929866812 2:45724518-45724540 ATGATGAAGCTTAGTGAGGAAGG + Intronic
930949467 2:57121466-57121488 AGGTTGCAGCAGAGTTAGAAAGG - Intergenic
931743072 2:65266426-65266448 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
931766524 2:65461544-65461566 ATGCTGCAGCTATGTGATGAGGG - Intergenic
931830492 2:66045916-66045938 ATCCGGCAGCAGGGTGTGGATGG + Intergenic
932574104 2:72953416-72953438 ATGCTGCTGTAGACTCAGGAGGG + Intronic
932659964 2:73643247-73643269 ATGCAGCTAGAGAGTGAGGAAGG + Intergenic
932666532 2:73702906-73702928 ATGCAGCTAGAGAGTGAGGAAGG + Intergenic
932757166 2:74416969-74416991 ATGCTGCAGCAGAGAGAGCAAGG - Intronic
933082891 2:78015576-78015598 ATGATTAAGCATAGTGAGGAAGG - Intergenic
933302644 2:80559828-80559850 TTGCTGCAGGAGGCTGAGGAGGG + Intronic
933845937 2:86327404-86327426 AGGCTGCAGCTGAGTGAGAGAGG + Intronic
934087316 2:88520678-88520700 CTGCTGCAGCAGAGCCAGGAGGG - Intergenic
934681211 2:96285223-96285245 ATGCTGCTGCAGAGCTCGGAGGG - Exonic
936773031 2:115937966-115937988 ATGCTGCAGCAGAGTACAGTGGG + Intergenic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937835805 2:126469308-126469330 AGGCTGCTGCAAAGTGATGAGGG - Intergenic
937869148 2:126775413-126775435 GTGCTGCACCAGAGGGACGAGGG + Intergenic
938758405 2:134401397-134401419 ATGATGTAGCAGACTCAGGAAGG - Intronic
939014467 2:136886107-136886129 ATGCAGGAGCAGAGTGAACATGG + Intronic
939097704 2:137853620-137853642 ATGCTGCAGCCAAGGGAGCAAGG + Intergenic
940491975 2:154374095-154374117 ATACTGCACAAGAGTGAAGAAGG - Intronic
941196628 2:162460279-162460301 TGGCTGCAGCAGAGTGAGTTTGG - Intronic
941265658 2:163358405-163358427 CTGCTGCAGAGGAGTGGGGAGGG + Intergenic
941521622 2:166552386-166552408 AGCATGCAGTAGAGTGAGGAAGG + Intergenic
942539929 2:177005374-177005396 ATGATTAAGCATAGTGAGGAAGG + Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
945397595 2:209339310-209339332 CTCTTGCAGCAGAGTGAGAAGGG - Intergenic
945560148 2:211329799-211329821 ACGCTGCAGCAGAGTGCAGCAGG - Intergenic
945575119 2:211521128-211521150 ATGATTAAGCATAGTGAGGAAGG + Intronic
946368588 2:219266501-219266523 CTGCTGCAGGATAGTGAGCAGGG - Intronic
946855740 2:223948084-223948106 AGGCTGGAGCAGAGTGAGTGAGG + Intergenic
946884361 2:224208339-224208361 CTGCTGGAGCAGTGTGAGCAAGG + Intergenic
946901307 2:224374488-224374510 ATGGTGCAGCTTAGTGAAGATGG + Intergenic
947045269 2:225975368-225975390 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG + Intronic
948257945 2:236581653-236581675 ATGCTTGAGTAGAGTGAAGAGGG + Exonic
948494403 2:238337566-238337588 AGGCTGCAGCGCAGCGAGGAGGG + Intronic
1168776230 20:449784-449806 ATGTTGTTTCAGAGTGAGGAGGG - Intronic
1169402392 20:5294173-5294195 ATCCTGCAGCAGAGCCAGCAAGG - Intergenic
1169756709 20:9050643-9050665 ATGATGAAGCTGAGTGAGGTAGG - Intergenic
1170832825 20:19858274-19858296 AGGCTACATCTGAGTGAGGAAGG + Intergenic
1170942294 20:20858511-20858533 CTGATGCAGCAGTGTGAGTAGGG + Intergenic
1171414325 20:24967394-24967416 TTCCTGCAGCTGGGTGAGGAGGG - Intronic
1171512132 20:25694754-25694776 ATGCTGTACCAGAGTCAGGTTGG - Intronic
1173888105 20:46479542-46479564 ATGCTACACTAGAGTCAGGATGG - Intergenic
1174181954 20:48680550-48680572 TGGCTGCCTCAGAGTGAGGAGGG - Intronic
1174202219 20:48814693-48814715 CACCTCCAGCAGAGTGAGGATGG + Intronic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174405108 20:50297709-50297731 TGGTTGCAGCAGAGAGAGGAAGG - Intergenic
1175118946 20:56703568-56703590 ATGCTGCACAACACTGAGGAAGG - Intergenic
1175268191 20:57715073-57715095 ACTCTGCAGCGGAGTGAGGCTGG + Intergenic
1176801633 21:13436002-13436024 CTGGTGCAGCAGAGAGAGGGAGG - Intergenic
1176840180 21:13834727-13834749 ATGGTGCAGTAGAGTGATCATGG + Intergenic
1177461438 21:21416055-21416077 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1178016379 21:28351126-28351148 ATGCGGGAGGAGAGGGAGGAAGG - Intergenic
1178181249 21:30163952-30163974 ATACTGCAGCAGAGTGGAGCAGG + Intergenic
1178261500 21:31104271-31104293 ATGCTGCAGCGGAGTGCAGTGGG - Intergenic
1178704381 21:34861314-34861336 ATGCTGCCGCAGAGGGAGGCAGG + Intronic
1178906733 21:36642797-36642819 TTGCTGGAGAAGAGTGGGGAAGG - Intergenic
1179372002 21:40815058-40815080 ATGCTGCAGCCCAGTGATGCAGG + Intronic
1179639564 21:42738432-42738454 TTGCTGGAGCACAGTGAGGCTGG + Intronic
1179780391 21:43696438-43696460 AGGCTGCAGCTGGGTGAGGCGGG + Intergenic
1180713100 22:17853298-17853320 AGGCTGCAGCAGAGTGGGCTGGG - Intronic
1180933475 22:19608971-19608993 TGGCTGCAGCACAGTGAGAATGG - Intergenic
1180957489 22:19747434-19747456 AGGCTGCAGAGGTGTGAGGAGGG + Intergenic
1181041733 22:20195532-20195554 AGGCTGGGGCAGGGTGAGGACGG - Intergenic
1182510108 22:30813589-30813611 CTGCAGCAGCTGGGTGAGGATGG - Intronic
1183255965 22:36762403-36762425 GGGCTGCAGCAAGGTGAGGATGG + Intronic
1183669216 22:39262510-39262532 GGGCTGCAGCAGAGAGAGGTGGG - Intergenic
1184714454 22:46273033-46273055 AGGCTGCAGCAGGGTGAGAAGGG - Intronic
1184773961 22:46613976-46613998 CGGCTGCAGCAGTGTGAGGAGGG + Intronic
1185076402 22:48685495-48685517 ATGCTGCACCAGAGTCAGGTTGG + Intronic
1185139157 22:49090626-49090648 AAGGTGCTGCAGAGTGAGGCTGG + Intergenic
1185178021 22:49341406-49341428 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
949109305 3:239408-239430 ATGCTGCAGCAGAGAAAAAAGGG - Intronic
950155042 3:10715690-10715712 ATGCTGGAGCTGAGTGTGGTGGG + Intergenic
950246322 3:11422711-11422733 ATGATTAAGCATAGTGAGGAAGG - Intronic
950266398 3:11576487-11576509 ACACTGCAGCTCAGTGAGGAAGG - Intronic
950399687 3:12760400-12760422 TTACTGGAGCAGAGTGAGGGAGG - Intronic
950426680 3:12928143-12928165 ATGCTGCAGCAGAGGTGGGAGGG + Intronic
950455939 3:13092814-13092836 TGCCTGGAGCAGAGTGAGGAGGG - Intergenic
950523084 3:13507876-13507898 CTGAGGCAGCAGAGTGGGGATGG - Intergenic
950582545 3:13871940-13871962 TGGCTGGAGTAGAGTGAGGAAGG - Intronic
950644334 3:14368169-14368191 AGGCCTCAGCAGAGTGAGGAGGG - Intergenic
950928127 3:16763635-16763657 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
951530056 3:23690371-23690393 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
951857460 3:27213744-27213766 ATGCTACACCAGAGTCAGGTTGG - Intronic
952763394 3:36934969-36934991 ATGCTGGAGCTGGGTGAGGGTGG - Intronic
952849951 3:37719639-37719661 GTGCTGCACCCGAGTCAGGAGGG + Intronic
953882780 3:46700308-46700330 AGGCTGCAGCAGGGAGCGGAGGG - Intergenic
954299428 3:49691529-49691551 CTGGCCCAGCAGAGTGAGGAGGG - Intronic
954898776 3:54000900-54000922 GTCCTGCAGGAGAGTGAGGTTGG + Intergenic
955018566 3:55096310-55096332 TGGCTGCAGCAGAGTGAGCAAGG - Intergenic
955905837 3:63806785-63806807 ATACTGAAGCAGAGTCAGGCAGG - Intergenic
956570049 3:70684121-70684143 AGGCTGGAGCACAGAGAGGAAGG - Intergenic
957863711 3:85994577-85994599 ATGATGAAGCTTAGTGAGGAAGG - Intronic
958040044 3:88216381-88216403 ATGTTTCAGCAGAGTCAAGATGG - Intergenic
958055040 3:88399421-88399443 ATGCAGGAGCAGAGTGAGTGAGG - Intergenic
958456877 3:94343402-94343424 ATGCTGTAGCAAAGGAAGGAAGG - Intergenic
958795310 3:98700842-98700864 AGTCTGAAGCAGACTGAGGAAGG + Intergenic
959873540 3:111355664-111355686 ATGATGAAGCTTAGTGAGGAAGG + Intronic
961092165 3:124122877-124122899 ATGATGAAGCTTAGTGAGGAAGG + Intronic
961829401 3:129615774-129615796 AGGATGCAGCAGAGTCAGGAGGG + Intergenic
962187022 3:133270910-133270932 AAGCTGCACCAGAGTGAGTGAGG - Intronic
962535705 3:136327283-136327305 ATGCTGTAGGAAAGTGAGCAGGG - Intronic
962698686 3:137975824-137975846 TGGCTGCAGCAGAGTGAGGTGGG - Intergenic
962744120 3:138384832-138384854 ATCCTGCAGCCAAGTGAAGAAGG + Intronic
964245040 3:154642094-154642116 AAGCTGTAGCTAAGTGAGGAGGG - Intergenic
964419696 3:156488516-156488538 TGGCTGCAGCAGAGTAAGGAAGG + Intronic
964535024 3:157711412-157711434 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
965449577 3:168820855-168820877 ATGCTGCAGCAGGATGAATATGG + Intergenic
966567199 3:181396576-181396598 TGGCTGCAGTAGAGTGAGGCTGG + Intergenic
966605853 3:181820929-181820951 TGGCTGGAGCAGAGTGAGCAGGG - Intergenic
968471355 4:783936-783958 TTGTTACAGCTGAGTGAGGAAGG - Intergenic
968546361 4:1200936-1200958 CTGCTGCAACAGAGCCAGGAGGG - Intronic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
969217901 4:5736938-5736960 ATTATGAAGCATAGTGAGGAAGG + Intronic
969352024 4:6603543-6603565 ATACTGCATCTGAGTGGGGAAGG - Intronic
969369004 4:6719263-6719285 AGGCTGCAGGGGAGTGAGCAAGG - Intergenic
970105026 4:12572537-12572559 ATGATTCAACAGAGAGAGGAAGG - Intergenic
970267868 4:14309325-14309347 AGGCTGCAGCAGAGAGTGGGAGG - Intergenic
970689655 4:18607883-18607905 AGGCTGGAGAAGAGGGAGGACGG - Intergenic
971261964 4:25065474-25065496 AGGCAGCAGCAGGGTGTGGAGGG - Intergenic
972189332 4:36571015-36571037 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
972418306 4:38863973-38863995 TGGCTGGAGCAGAGGGAGGATGG - Intergenic
972425269 4:38927023-38927045 TGGCTGCAGCAGAGTGAGGCAGG - Intronic
972947898 4:44280523-44280545 AAGCTGCTCCAGAGTGAAGAAGG + Intronic
972952503 4:44344925-44344947 AAGCTGAAGAACAGTGAGGAGGG - Intronic
973167658 4:47097243-47097265 TGGCTGGAGCAGAGTGAGAAAGG - Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
974756591 4:66217128-66217150 AGCATGCAGCAGAGTGTGGAGGG - Intergenic
975034955 4:69668759-69668781 CTGCTGCTGTGGAGTGAGGAGGG - Intergenic
975206232 4:71646784-71646806 ATGCTATAGCAGAGTCAGGCTGG + Intergenic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
976718765 4:88150416-88150438 AGGCTGAAGCAGAGTGAGGGAGG + Intronic
977153382 4:93542639-93542661 ATGCTGAAAAAGTGTGAGGAGGG + Intronic
977593083 4:98848615-98848637 TGCCTGCAGCAGAGTGGGGAAGG + Intergenic
977848006 4:101789300-101789322 ATTGTGGAGCAGAGTCAGGATGG + Intronic
978894569 4:113871559-113871581 ATGCTACACCAGAGTCAGGTTGG + Intergenic
979250787 4:118564803-118564825 AAGCTGCAGCAGAGTGTGCCTGG + Intergenic
981064545 4:140469014-140469036 GTGCTGCAGTAGAGAGAGGAGGG - Intronic
981391918 4:144200967-144200989 ATGATTCAGCTTAGTGAGGAAGG - Intergenic
982900916 4:161002527-161002549 ATCCAGGTGCAGAGTGAGGAGGG + Intergenic
982918266 4:161242100-161242122 GTGCTGCAGGAGAATGATGATGG - Intergenic
983515734 4:168654714-168654736 GAGCTGCAGCAGAGCGGGGAGGG - Intronic
983658473 4:170107449-170107471 ATGATTCAGCTTAGTGAGGAGGG - Intergenic
984010530 4:174366229-174366251 TGGCTGCAGGACAGTGAGGATGG + Intergenic
985018514 4:185662130-185662152 ATGCTGGAGTTGAGTGAGGCTGG + Exonic
985328340 4:188797762-188797784 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
985718261 5:1475120-1475142 AGGATGAAGCAGAGTGAGGCGGG + Intronic
985946893 5:3192599-3192621 AGGCTGCACCACAGTGAAGATGG - Intergenic
987328967 5:16838188-16838210 ATGACGCAGCTGAGTGAGGAAGG + Intronic
987744543 5:21952867-21952889 ATGCTGTACCAGAGTCAGGTTGG - Intronic
987797260 5:22644195-22644217 ATGGTGAAGCATAGTGAAGAAGG + Intronic
987835769 5:23159503-23159525 ATGCTGCAGAAGAGTGCAGCAGG + Intergenic
988627099 5:32889004-32889026 AGGCTGGAGCAGAGTGGGCAAGG - Intergenic
990108567 5:52294193-52294215 ATTCTGCAGCCCTGTGAGGAAGG - Intergenic
991764749 5:69962989-69963011 ATGCTGTACCAGAGTCAGGTTGG - Intergenic
991782575 5:70155164-70155186 ATGCTGTACCAGAGTCAGGTTGG + Intergenic
991843981 5:70838060-70838082 ATGCTGTACCAGAGTCAGGTTGG - Intergenic
991875018 5:71155477-71155499 ATGCTGTACCAGAGTCAGGTTGG + Intergenic
992614201 5:78534060-78534082 ATGCTGGGGCAGGGAGAGGAGGG + Intronic
993138784 5:84003334-84003356 CTGCTGCCACAAAGTGAGGAGGG + Intronic
994285626 5:97962196-97962218 AAGCTGAAGCAGAGTAAGGCAGG - Intergenic
995642963 5:114278585-114278607 ATGCTGGAGCAAGGTGGGGAAGG - Intergenic
996058719 5:119009237-119009259 ATGCTGACTCAGACTGAGGATGG + Intergenic
996139418 5:119887747-119887769 AGGCTGGAGCAGAGTAAGCAAGG - Intergenic
996220310 5:120924131-120924153 GAGTTGCAGCAGGGTGAGGAAGG - Intergenic
997415669 5:133726479-133726501 CTTCTGGAGGAGAGTGAGGATGG - Intergenic
997656355 5:135557653-135557675 CTGCTGCAGTGGAGAGAGGATGG + Intergenic
997694688 5:135851864-135851886 AGGCTGCAGGAGGCTGAGGAGGG - Intronic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
999793545 5:154966141-154966163 ATGCTGAAGCATAGTAAGCAAGG - Intronic
1000054143 5:157589181-157589203 ATGCGGCAGTAGTGAGAGGAGGG - Intergenic
1000158376 5:158574631-158574653 AGGCTGGAACAGAGTGAGCAAGG + Intergenic
1000886704 5:166755886-166755908 ATGATTCAGCTTAGTGAGGAAGG + Intergenic
1001479770 5:172080398-172080420 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1001483076 5:172101908-172101930 AGGCTGGAGAAGAGTGAGGCTGG + Intronic
1001577529 5:172773861-172773883 ATGCTGCTTCTGACTGAGGATGG + Intergenic
1001763965 5:174230387-174230409 TAGCTGCAGCAGAGTGAGTTTGG - Intronic
1001917181 5:175571590-175571612 ATGCAGGAGCAGGGAGAGGAAGG - Intergenic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1002915571 6:1525502-1525524 ATGCTGGAGCAGAATGGGAAGGG - Intergenic
1003245664 6:4379892-4379914 ATGCTCCAGCAGATCGGGGAGGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1004370536 6:15048625-15048647 AAGCTGCAGTAGAGTGGGGACGG + Intergenic
1004474688 6:15960282-15960304 ATGCTACACCAGAGTCAGGCTGG - Intergenic
1005820688 6:29596205-29596227 ATGCTGTATCAGAGTCAGGTTGG - Intronic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1006707669 6:36035553-36035575 ATGATTAAGCATAGTGAGGAAGG + Intronic
1007547942 6:42708453-42708475 AAGCTGGAGCAGTGTGAGGGGGG + Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007728415 6:43930982-43931004 TGGCTGGAGCACAGTGAGGAAGG + Intergenic
1007736336 6:43984622-43984644 AGGCTGGAGCAGAGTGAGCGAGG + Intergenic
1007963541 6:45983209-45983231 ATGCAGCAGCACAGGGAGGGAGG + Intronic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1009192785 6:60649834-60649856 ATGCTGCAGAAGAGAGTAGATGG - Intergenic
1010452296 6:76016563-76016585 ATGCTGATGCAGAGAGAGGCTGG + Intronic
1011423829 6:87203925-87203947 AAGCCTAAGCAGAGTGAGGAGGG + Intronic
1011824371 6:91288810-91288832 CTGATGCAGAAGAGTGAGAAGGG + Intergenic
1012417734 6:99027779-99027801 TGGCTGCAGCTGAGTGAGCAAGG + Intergenic
1012729769 6:102867287-102867309 ATACTGCAGCTGAGAGAGGCTGG - Intergenic
1013710508 6:112891901-112891923 AGGAGGCAGGAGAGTGAGGAAGG - Intergenic
1013774183 6:113660849-113660871 AAGCTGGAGCAGATTGAGTATGG + Intergenic
1014837317 6:126174105-126174127 AGGCTGCAGAAAGGTGAGGAAGG - Intergenic
1015067621 6:129050514-129050536 GTTCTGCAGAAGAGAGAGGATGG + Intronic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015666801 6:135639939-135639961 ATGCTGCACAAAGGTGAGGAAGG - Intergenic
1015732573 6:136363370-136363392 ATTCTGCACCACAGTGAGCAAGG + Intronic
1015809084 6:137143225-137143247 GTGCTGGAGAAGAGTGAGGAAGG + Intergenic
1016132019 6:140485708-140485730 ATGCTGCAGAAAAGTGGAGAGGG - Intergenic
1016471425 6:144378641-144378663 GTGCTGGAGCAAACTGAGGAGGG + Intronic
1016695750 6:146992942-146992964 CTGCTGATGAAGAGTGAGGAAGG - Intergenic
1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG + Intergenic
1017299590 6:152841015-152841037 ATGCTGCAGAAGAGTGCAGTGGG + Intergenic
1017385003 6:153873217-153873239 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1019759297 7:2797609-2797631 ATGCTGCAGGAGAGAGATGAAGG - Intronic
1020939397 7:14511701-14511723 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1022471784 7:30686059-30686081 ATGAAGCAGGAGGGTGAGGATGG - Intronic
1023088075 7:36592326-36592348 AGGCTGTAGCAGAGGGAAGATGG + Intronic
1023193517 7:37609473-37609495 ATGATTAAGCATAGTGAGGAAGG + Intergenic
1023255399 7:38307806-38307828 AAGCTGCACCAGGATGAGGAAGG + Intergenic
1023851247 7:44151658-44151680 AAGCTGCAGGGGTGTGAGGACGG + Intronic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024549327 7:50548301-50548323 ATGATTCAGCTGAGTGAGGAAGG + Intronic
1026256103 7:68713213-68713235 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1026642137 7:72136657-72136679 ATGATTAAGCATAGTGAGGAAGG - Intronic
1027006055 7:74693951-74693973 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1027602941 7:80261918-80261940 TGGTTGCAGCATAGTGAGGAAGG - Intergenic
1028163359 7:87510421-87510443 ATCCTGCAGAAGACTGGGGAGGG + Intronic
1028276389 7:88863104-88863126 TTGCTGTAGCATAGTGAGCACGG - Intronic
1029152595 7:98491539-98491561 AGGCTGCAGCAGCTTGAGGCGGG + Intergenic
1029210897 7:98907754-98907776 GTGCTGCAGCAGATTGGAGAGGG - Intronic
1029555261 7:101264508-101264530 ATGCTTCTGCAGGGCGAGGAAGG - Intergenic
1029906633 7:104099765-104099787 ACGTTGCAGCACAGTGAGGGTGG + Intergenic
1030151097 7:106405956-106405978 ATGATTCAGCTTAGTGAGGAAGG - Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030172912 7:106622663-106622685 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1030641600 7:112012415-112012437 ATGCTAAGGCAGAGTTAGGAAGG + Intronic
1030856320 7:114562153-114562175 ATGCTGCAGCAGGGTCAGAAAGG - Intronic
1031886107 7:127247585-127247607 TTGGTGGGGCAGAGTGAGGATGG + Intronic
1033322122 7:140349444-140349466 ATGCTGCAGCTGCATGAAGATGG + Intronic
1033801283 7:144905400-144905422 ATGCTGCACTAGAGTCAGGCTGG + Intergenic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034970026 7:155413089-155413111 CTCCAGCAGCAGGGTGAGGAAGG + Intergenic
1034972006 7:155425045-155425067 ATGCTGCAGCTGTATGAGGCAGG - Intergenic
1035550178 8:517199-517221 ATGCTGTACCAGAGTTAGGTTGG - Intronic
1035744210 8:1950119-1950141 ATGCAGCTGCACAGTGAGGTTGG - Intronic
1035850990 8:2919167-2919189 ATGCTGCAGGAGAAGGAGAAAGG - Intergenic
1036773606 8:11595006-11595028 ATGATGCCACAGGGTGAGGATGG - Intergenic
1037209681 8:16371350-16371372 ATGCTGTACCAGAGTCAGGTTGG + Intronic
1037624959 8:20598580-20598602 AACCTTAAGCAGAGTGAGGAGGG - Intergenic
1037992912 8:23333306-23333328 ATCCCCCAGGAGAGTGAGGAAGG - Intronic
1038359500 8:26863694-26863716 ATTCTGTAGCAGAGTGAAAATGG + Intronic
1038424623 8:27456652-27456674 ATGATTAAGCTGAGTGAGGAAGG + Intronic
1039148290 8:34474768-34474790 ATGCTGGAACAGAATGAGTAAGG + Intergenic
1039337356 8:36606479-36606501 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1039379834 8:37074716-37074738 ATGATTGAGCAGAGAGAGGAAGG - Intergenic
1040485209 8:47864637-47864659 GTGCCACAGCAGAGTGAGGAGGG + Exonic
1042011429 8:64249696-64249718 CTTCGGCAGCAGAGTGAGGGAGG - Intergenic
1042109213 8:65361512-65361534 ATGCTTCATCAGAGTAAGCAAGG - Intergenic
1042333594 8:67608057-67608079 AGGCTGCAGAAGAGGAAGGAAGG + Intronic
1044436634 8:92171838-92171860 ATGGTCCACCAGAGTGAGAAAGG - Intergenic
1044576287 8:93773268-93773290 TGGCTGGAGCAGAGTGAGCAGGG + Intronic
1044708964 8:95036947-95036969 ATGCTCCAGCAGAATGGGGAAGG - Intronic
1044733686 8:95255280-95255302 ATGCTGGAGCATAATGAGTAGGG - Intronic
1045152969 8:99429956-99429978 TGGCTTCAGCAGAGTGAGCAAGG - Intronic
1046316780 8:112513262-112513284 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1046975532 8:120271955-120271977 ATGGTCCAGCAGAGTGATCATGG + Intronic
1047171062 8:122492626-122492648 TGGCTGCAGCAGAGTTAGCAAGG + Intergenic
1047236817 8:123048900-123048922 AGGCTGGAGCAGAGTGACAAGGG - Intronic
1048206297 8:132417924-132417946 AGAGGGCAGCAGAGTGAGGATGG + Intronic
1048607946 8:135989694-135989716 ATGGGGCAGCACAGTGAAGATGG - Intergenic
1048861448 8:138727175-138727197 GTGCTGGAGCTGAGGGAGGAGGG - Intronic
1048938572 8:139377225-139377247 AGGCTGGATGAGAGTGAGGAGGG - Intergenic
1048967606 8:139625689-139625711 CAGCTGCAGCAGAGAGATGAAGG - Intronic
1048982090 8:139708029-139708051 ATGCTGCAGCTGAATGAGTTTGG - Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049289498 8:141794298-141794320 AGGCTGCAGCTGGGAGAGGAGGG - Intergenic
1049542178 8:143213645-143213667 AGGCTGCAGGACAGTGAGTAGGG + Intergenic
1050185633 9:2969901-2969923 ATGCTGGAGCAGAGTGAGTGAGG + Intergenic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1051154913 9:14131761-14131783 AGGCTGCTACAGACTGAGGAAGG - Intronic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052349727 9:27446345-27446367 ATCCTGCAGCAGAAAGAAGATGG + Intronic
1053370699 9:37559308-37559330 ATGCTGCATCAAAGTGTGGGTGG - Intronic
1053486143 9:38457870-38457892 CTGTTTCAGCAGAGTGATGAGGG + Intergenic
1053578955 9:39383112-39383134 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1053620637 9:39810637-39810659 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053626072 9:39873298-39873320 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1053843467 9:42211187-42211209 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1053878803 9:42569923-42569945 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053893869 9:42724448-42724470 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1053911038 9:42904296-42904318 ATGCTGCACCAGAATCAGGTTGG + Intergenic
1054100538 9:60941916-60941938 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054121934 9:61217541-61217563 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054217816 9:62377403-62377425 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1054232886 9:62531772-62531794 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054263526 9:62896807-62896829 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054585808 9:66964970-66964992 ATGATTGAGCTGAGTGAGGAAGG + Intergenic
1055293641 9:74811883-74811905 ATGCTGGAGAAGAGTGCAGAAGG + Intronic
1056353547 9:85775838-85775860 ATGGTGCACCAGATTGAGGTTGG + Intergenic
1056751737 9:89356931-89356953 CTGGTGCACCAGAGAGAGGATGG - Intronic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1057445643 9:95112585-95112607 AGGCTGTACCAGAGTGAGGAGGG + Intronic
1057734076 9:97637064-97637086 GTGCTGGAGCAGAGTGAGTGAGG + Intronic
1059371521 9:113843400-113843422 ATGCGGAAGGAGAGGGAGGAAGG - Intergenic
1059972972 9:119686336-119686358 TTTCTGCAGCAGAGTGACGGTGG - Intergenic
1060054693 9:120403409-120403431 GTGCAACAGCAGAGTGATGAAGG + Intronic
1061561608 9:131407786-131407808 AAGCTGTGGTAGAGTGAGGAGGG + Intronic
1062073558 9:134572254-134572276 GTGCTGCGGCAGAGTGGGGGTGG - Intergenic
1062264774 9:135681943-135681965 AGGCTGCAGCAGAGACAGGGTGG - Intergenic
1062633780 9:137479168-137479190 ATCCTGCTGCACAGGGAGGAGGG - Exonic
1185955822 X:4487878-4487900 ATGCTGCAGAAGAGTGCAGTGGG + Intergenic
1186071739 X:5828277-5828299 ACACTGCAGCAGAGTGAAGAGGG + Intergenic
1187699042 X:21947187-21947209 ATGCTGAAGGAGCGGGAGGAAGG - Intronic
1188156698 X:26749529-26749551 ATGCTGCAGCAGAGCTGGCAAGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189249981 X:39593277-39593299 ATGCTGGTGGAGAGTGAGAAAGG - Intergenic
1189290544 X:39882331-39882353 AGGATGAAGCAGAGTGGGGAGGG + Intergenic
1189995442 X:46633010-46633032 ATCCTGCCTCAGAATGAGGAAGG - Intronic
1190124379 X:47690403-47690425 ATGCTGCAGGAGCCTGATGAGGG + Intergenic
1190321490 X:49182468-49182490 CTGCTGGCGCAGAGTGAGCAAGG - Intronic
1190360322 X:49643254-49643276 ATGCTGTACTAGAGTCAGGATGG - Intergenic
1190393838 X:49959873-49959895 TTGCTGAAGCAGAGTGAAAATGG - Intronic
1190460801 X:50671885-50671907 ATGCTTAAGCTTAGTGAGGAAGG - Intronic
1190781413 X:53599758-53599780 ATGCTGCAGACAAGTGAGAAGGG + Intronic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192219665 X:69188873-69188895 CTGCTACTGCAGAGTGAGGTAGG - Intergenic
1193769454 X:85571832-85571854 ATGCTCCAGCAGGGTGGTGATGG - Intergenic
1194165361 X:90508141-90508163 TTGCTGCAGCTGCGTGGGGATGG - Intergenic
1194364727 X:93000843-93000865 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1194846495 X:98815740-98815762 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1195952316 X:110287948-110287970 AAGCTCCTGAAGAGTGAGGATGG - Intronic
1196178876 X:112668929-112668951 AGTTTCCAGCAGAGTGAGGAGGG - Intronic
1196830611 X:119772786-119772808 TGGCTGGAGCAGAGTGAGGGAGG - Intergenic
1198312953 X:135438105-135438127 GTGCTGCAGCAGTGGCAGGAGGG + Intergenic
1198621337 X:138514068-138514090 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1198826259 X:140701250-140701272 ATGCCTCAGCAGAATAAGGAAGG + Intergenic
1198844350 X:140894213-140894235 ATGCTGCAGAAGAGTGCAGCGGG - Intergenic
1200250103 X:154548217-154548239 TAGCTGGAGCAGAGTGAGGGAGG + Intronic
1200511629 Y:4085951-4085973 TTGCTGCAGCTGCGTGGGGATGG - Intergenic