ID: 1015525672

View in Genome Browser
Species Human (GRCh38)
Location 6:134174015-134174037
Sequence GGGTTGGCATTCATAAGCTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015525666_1015525672 18 Left 1015525666 6:134173974-134173996 CCACAGATGCACGGCACATACAA 0: 1
1: 0
2: 1
3: 7
4: 72
Right 1015525672 6:134174015-134174037 GGGTTGGCATTCATAAGCTCAGG 0: 1
1: 0
2: 0
3: 10
4: 80
1015525664_1015525672 30 Left 1015525664 6:134173962-134173984 CCTTACAGTTCTCCACAGATGCA 0: 1
1: 0
2: 0
3: 20
4: 349
Right 1015525672 6:134174015-134174037 GGGTTGGCATTCATAAGCTCAGG 0: 1
1: 0
2: 0
3: 10
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015525672 Original CRISPR GGGTTGGCATTCATAAGCTC AGG Exonic
903492853 1:23743114-23743136 GCGTTGGCATTTATAAGGCCAGG + Intergenic
906783003 1:48589300-48589322 GGTTTGACATTCAAAAGTTCTGG + Intronic
910984646 1:92993566-92993588 GAATTGGCATACATAAGCTCAGG + Intergenic
912321266 1:108715893-108715915 GGGTTTGGATTCAGGAGCTCTGG - Intronic
912663181 1:111553284-111553306 GGCTTGGGATTCCTCAGCTCTGG + Intronic
918799453 1:188953673-188953695 GGCTTGGCATTCCTGAGCTGTGG - Intergenic
922330236 1:224568505-224568527 GCCTTGGCCTTCAGAAGCTCTGG - Intronic
923198816 1:231692446-231692468 GGGGTGGCATTGATAATCTCTGG - Intronic
1067341240 10:45406039-45406061 AGGATGGCAGTCATGAGCTCTGG + Intronic
1067423519 10:46181335-46181357 GAGCTGGCACTCATTAGCTCTGG + Intergenic
1068346846 10:55791987-55792009 GAGCTGGCACTCATTAGCTCTGG - Intergenic
1070877877 10:79831186-79831208 GAGCTGGCACTCATTAGCTCTGG - Intergenic
1071644379 10:87347227-87347249 GAGCTGGCACTCATTAGCTCTGG - Intergenic
1080789772 11:35511935-35511957 AGGTTGGCTCTCAAAAGCTCAGG - Intronic
1085237938 11:75029861-75029883 GGGGTGGCATTCATTGGCACTGG - Intergenic
1088665078 11:112086339-112086361 GGGCTGGCATTCGAAAGATCTGG - Intronic
1091295588 11:134472034-134472056 GAGTTGGCATGCAGAAGCTGGGG + Intergenic
1092099831 12:5873919-5873941 GGGTTGGGGTACATCAGCTCTGG - Intronic
1101210766 12:102533466-102533488 GGGTGGGCAGCCATAAGCTCCGG - Intergenic
1102036996 12:109776401-109776423 TGTTTGGGATTCATAATCTCAGG - Intergenic
1112470083 13:99680385-99680407 GAGATGGCATTCATAAGGTTAGG + Intronic
1119651560 14:76387437-76387459 GGGTGAGCCTTCAGAAGCTCAGG + Intronic
1122279637 14:100613858-100613880 GGGTTGGATTTCCTGAGCTCAGG - Intergenic
1135125691 16:19807536-19807558 TGGTTGGCATGCAGAATCTCAGG + Intronic
1136526430 16:30834360-30834382 GCGCTGGCATACATAAGCCCTGG + Exonic
1139179088 16:64724664-64724686 GGGTTGCCAGTCAAAATCTCAGG - Intergenic
1142435638 16:90055184-90055206 GGGCTGGCATTGAGAAGCTGAGG - Intergenic
1147001813 17:37368722-37368744 TGGTTGGTACTCAGAAGCTCAGG - Intronic
1147754577 17:42760347-42760369 GGATTTGAATTCAGAAGCTCTGG - Intronic
1148393685 17:47291724-47291746 TGGTGGTCAATCATAAGCTCAGG - Intronic
1157803679 18:50642310-50642332 GGGGTGGAATTCTTCAGCTCTGG - Intronic
1158305209 18:56097714-56097736 GGGTTGGCACTGAAGAGCTCTGG - Intergenic
1163672962 19:18639290-18639312 GGTCTGGCATTCCTGAGCTCAGG + Intronic
1166578074 19:43863978-43864000 GGGTTGGCACTCCTAACCTCTGG + Intergenic
1166643860 19:44516793-44516815 GGGTTGGGATTCAACAGCTGTGG + Intronic
1167723072 19:51192247-51192269 GAGATGGCATTCAGCAGCTCAGG + Intergenic
939932613 2:148254139-148254161 GGGTGGGCATCCCTAGGCTCTGG - Intronic
947088212 2:226479297-226479319 GGGTTAGCATTCTTAACCACAGG - Intergenic
1169027298 20:2381687-2381709 GGGGTGGAATTCTTGAGCTCAGG + Intronic
1173019961 20:39258827-39258849 GGGTTGGTATTCTTCATCTCTGG + Intergenic
1178311462 21:31533502-31533524 GGGTTGGCCTTCCTAAGTGCTGG - Intronic
1181237501 22:21456537-21456559 GGGCTGGGATTCAAATGCTCTGG - Intergenic
949926411 3:9045863-9045885 GGGTTGGTATTTATAGGCACAGG - Intronic
952175286 3:30855692-30855714 GGCTTGGCATTCTCAATCTCAGG + Intronic
955234795 3:57130203-57130225 TGGGTGGCCTTCATGAGCTCTGG - Intronic
960214783 3:115018519-115018541 GGCTTGGCATTCATTAACTATGG + Intronic
960692516 3:120361681-120361703 GGAATGGCATTAACAAGCTCAGG - Intergenic
963069308 3:141289777-141289799 GGGTTAGCATCCATCAGCCCTGG + Intronic
965814516 3:172622847-172622869 GGGGTGGCCTTCAAAAGCTGGGG - Intergenic
968443349 4:635721-635743 GGATTGGCACACACAAGCTCAGG - Intronic
970010345 4:11451922-11451944 GGGTTGTGATTCATCAGATCTGG - Intergenic
970025462 4:11619337-11619359 GGTTTGGCCTTGATAAGATCAGG - Intergenic
972826264 4:42762837-42762859 GGGTGGGCATTCATGTGCACTGG - Intergenic
975767401 4:77683356-77683378 GGGGTTGCATTCATATGGTCAGG + Intergenic
976603362 4:86959744-86959766 AGGTTGGCTTTCATGAGCTGTGG + Intronic
980009699 4:127581442-127581464 GGGTTGGCAAACTTGAGCTCTGG - Intergenic
982373026 4:154655145-154655167 GGGTTGTGATTCAGAAGCTCCGG - Intronic
983289506 4:165784358-165784380 GGCTTGGAATTCCTAAGCTATGG + Intergenic
995975083 5:118025315-118025337 GGGTGGCCATACATAAGCTAAGG - Intergenic
997148201 5:131461134-131461156 GTTTTGACATTCATAAGCCCAGG - Intronic
998028740 5:138844804-138844826 AGATTGGCATTCATTGGCTCTGG + Intronic
1005008664 6:21314660-21314682 GGCTTGGCCTCCATGAGCTCCGG + Intergenic
1006773881 6:36576984-36577006 GGTTTTGAATTCCTAAGCTCAGG - Intergenic
1007250248 6:40490398-40490420 GGGCTGCCATTCTGAAGCTCAGG + Intronic
1010578312 6:77561792-77561814 GGGTTGGCTTTCCTAAGGTCAGG + Intergenic
1011541208 6:88432155-88432177 GTGTTGGCCTTCACAAGCTGTGG - Intergenic
1015525672 6:134174015-134174037 GGGTTGGCATTCATAAGCTCAGG + Exonic
1015621511 6:135136887-135136909 GGGTCAGCATACAAAAGCTCTGG + Intergenic
1016381685 6:143490626-143490648 GGATTGGAATTTACAAGCTCAGG + Intergenic
1020652024 7:10887302-10887324 TGGTTGGAATTCATCATCTCAGG + Intergenic
1023910971 7:44556215-44556237 GGGTTGGGTTTTATAAGCACAGG + Intergenic
1023912824 7:44567581-44567603 GGGTTGGCAGGCATGAGGTCAGG - Intronic
1025818953 7:64945645-64945667 GAGTTGGCATGCATATTCTCTGG - Intergenic
1031843924 7:126781364-126781386 GGGTTGGAATTTATAACCTAGGG - Intronic
1040755152 8:50764215-50764237 GGATTTGCCTCCATAAGCTCAGG + Intronic
1041188311 8:55326030-55326052 GGTTTGGCATTCAAAATCACAGG - Intronic
1042423580 8:68620340-68620362 GGGTTGGCATTCAGAGGGTCTGG + Intronic
1044256908 8:90074172-90074194 GGCTTGGCATTCAGAAGATGGGG + Intronic
1045327668 8:101128567-101128589 GGGTTGGAAGTCAGAGGCTCTGG + Intergenic
1048112634 8:131485357-131485379 GGGCTGTCATTGATAAGCACTGG - Intergenic
1048571399 8:135659983-135660005 GGGTTAGGGTTAATAAGCTCTGG - Intergenic
1052402984 9:28024392-28024414 TGGTTGGAATTGATGAGCTCAGG - Intronic
1056765258 9:89441217-89441239 GGGTTGGTATTCGTAAGGTCTGG - Intronic
1057350015 9:94288418-94288440 GGATTGGAATTTACAAGCTCAGG - Intronic
1190359158 X:49633219-49633241 GGATTGGAATTTACAAGCTCAGG - Intergenic
1193653932 X:84174639-84174661 GAGTTGACATTCAAAAGCACAGG - Intronic
1194283630 X:91983372-91983394 GGGTTGGAATTTACAAGCTCAGG - Intronic
1195752491 X:108172565-108172587 GGGTGGGCAGTCCTGAGCTCTGG - Intronic
1198507432 X:137314337-137314359 GGGCTGGCATTTGTCAGCTCTGG + Intergenic
1198981565 X:142403356-142403378 GAGTTGTCATTCATTAGCTGTGG + Intergenic
1200601203 Y:5207936-5207958 GGGTTGGAATTTACAAGCTCAGG - Intronic