ID: 1015527216

View in Genome Browser
Species Human (GRCh38)
Location 6:134185174-134185196
Sequence CTAAAGTTCTTGAGGAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015527216_1015527219 -3 Left 1015527216 6:134185174-134185196 CCAACTTTCCTCAAGAACTTTAG 0: 1
1: 0
2: 2
3: 39
4: 217
Right 1015527219 6:134185194-134185216 TAGAACTTTTCTTCCTGCCAGGG 0: 1
1: 0
2: 3
3: 14
4: 213
1015527216_1015527220 -2 Left 1015527216 6:134185174-134185196 CCAACTTTCCTCAAGAACTTTAG 0: 1
1: 0
2: 2
3: 39
4: 217
Right 1015527220 6:134185195-134185217 AGAACTTTTCTTCCTGCCAGGGG No data
1015527216_1015527218 -4 Left 1015527216 6:134185174-134185196 CCAACTTTCCTCAAGAACTTTAG 0: 1
1: 0
2: 2
3: 39
4: 217
Right 1015527218 6:134185193-134185215 TTAGAACTTTTCTTCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015527216 Original CRISPR CTAAAGTTCTTGAGGAAAGT TGG (reversed) Intronic
905134875 1:35791041-35791063 CTAAAGTCCACCAGGAAAGTAGG + Intergenic
905134875 1:35791041-35791063 CTAAAGTCCACCAGGAAAGTAGG + Intergenic
909339924 1:74520335-74520357 CTCAAATTCTTCAGAAAAGTCGG - Intronic
909339924 1:74520335-74520357 CTCAAATTCTTCAGAAAAGTCGG - Intronic
909375310 1:74934483-74934505 CTAACATTCCTGAGAAAAGTGGG - Intergenic
909375310 1:74934483-74934505 CTAACATTCCTGAGAAAAGTGGG - Intergenic
910098137 1:83547839-83547861 CTAAAGTTCTAGGGGAAGTTGGG - Intergenic
910098137 1:83547839-83547861 CTAAAGTTCTAGGGGAAGTTGGG - Intergenic
910823198 1:91373907-91373929 ATCAACTTCTTGAGGAAAGGGGG - Intronic
910823198 1:91373907-91373929 ATCAACTTCTTGAGGAAAGGGGG - Intronic
913585689 1:120273256-120273278 GTAAACTTCCTGAGAAAAGTGGG - Intergenic
913585689 1:120273256-120273278 GTAAACTTCCTGAGAAAAGTGGG - Intergenic
913622493 1:120625110-120625132 GTAAACTTCCTGAGAAAAGTGGG + Intergenic
913622493 1:120625110-120625132 GTAAACTTCCTGAGAAAAGTGGG + Intergenic
913648075 1:120880718-120880740 GTTAGGTTCATGAGGAAAGTTGG + Intergenic
913648075 1:120880718-120880740 GTTAGGTTCATGAGGAAAGTTGG + Intergenic
913970860 1:143415509-143415531 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
913970860 1:143415509-143415531 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
914065236 1:144241120-144241142 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
914065236 1:144241120-144241142 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
914078615 1:144382565-144382587 GTTAGGTTCATGAGGAAAGTTGG - Intergenic
914078615 1:144382565-144382587 GTTAGGTTCATGAGGAAAGTTGG - Intergenic
914100564 1:144583937-144583959 GTTAGGTTCATGAGGAAAGTTGG + Intergenic
914100564 1:144583937-144583959 GTTAGGTTCATGAGGAAAGTTGG + Intergenic
914113915 1:144725234-144725256 CTAAAGTTCTAGAAGAAAAAAGG + Intergenic
914113915 1:144725234-144725256 CTAAAGTTCTAGAAGAAAAAAGG + Intergenic
914173522 1:145251113-145251135 GTTAGGTTCATGAGGAAAGTTGG - Intergenic
914173522 1:145251113-145251135 GTTAGGTTCATGAGGAAAGTTGG - Intergenic
914298419 1:146353712-146353734 GTTAGGTTCATGAGGAAAGTTGG - Intergenic
914298419 1:146353712-146353734 GTTAGGTTCATGAGGAAAGTTGG - Intergenic
914384309 1:147153024-147153046 CTAAAGTTCAGGAGGAAAAGCGG - Intergenic
914384309 1:147153024-147153046 CTAAAGTTCAGGAGGAAAAGCGG - Intergenic
914528175 1:148492250-148492272 GTTAGGTTCATGAGGAAAGTTGG - Intergenic
914528175 1:148492250-148492272 GTTAGGTTCATGAGGAAAGTTGG - Intergenic
914567696 1:148885115-148885137 GTAAACTTCCTGAGAAAAGTGGG - Intronic
914567696 1:148885115-148885137 GTAAACTTCCTGAGAAAAGTGGG - Intronic
914605126 1:149245130-149245152 GTAAACTTCCTGAGAAAAGTGGG + Intergenic
914605126 1:149245130-149245152 GTAAACTTCCTGAGAAAAGTGGG + Intergenic
914638211 1:149574817-149574839 GTTAGGTTCATGAGGAAAGTTGG + Intergenic
914638211 1:149574817-149574839 GTTAGGTTCATGAGGAAAGTTGG + Intergenic
917822562 1:178779311-178779333 CTAAAGTTATTAAGGAAAGCAGG - Intronic
917822562 1:178779311-178779333 CTAAAGTTATTAAGGAAAGCAGG - Intronic
921332554 1:214054073-214054095 GTAAAGTTATTGAGTAAATTAGG - Intergenic
921332554 1:214054073-214054095 GTAAAGTTATTGAGTAAATTAGG - Intergenic
921527716 1:216238736-216238758 ATAATGTTTTTTAGGAAAGTGGG + Intronic
921527716 1:216238736-216238758 ATAATGTTTTTTAGGAAAGTGGG + Intronic
923893452 1:238241204-238241226 CTAATGCTAATGAGGAAAGTAGG + Intergenic
923893452 1:238241204-238241226 CTAATGCTAATGAGGAAAGTAGG + Intergenic
1065717270 10:28584405-28584427 CTAAAGTTACAGAGGTAAGTGGG + Intronic
1065717270 10:28584405-28584427 CTAAAGTTACAGAGGTAAGTGGG + Intronic
1065841063 10:29701473-29701495 CTAAGTCTCTTGAGGAAACTTGG - Intronic
1065841063 10:29701473-29701495 CTAAGTCTCTTGAGGAAACTTGG - Intronic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1066658378 10:37715921-37715943 CTAAAGTTCATGAGAAATGTTGG + Intergenic
1066658378 10:37715921-37715943 CTAAAGTTCATGAGAAATGTTGG + Intergenic
1067042872 10:42965610-42965632 CTGAAGTTCATGAGAAATGTTGG + Intergenic
1067042872 10:42965610-42965632 CTGAAGTTCATGAGAAATGTTGG + Intergenic
1068736451 10:60418476-60418498 CTATATTTCTTGAGGAAAAGTGG + Intronic
1068736451 10:60418476-60418498 CTATATTTCTTGAGGAAAAGTGG + Intronic
1069055394 10:63839530-63839552 CTAAGGTTGCTGATGAAAGTGGG + Intergenic
1069055394 10:63839530-63839552 CTAAGGTTGCTGATGAAAGTGGG + Intergenic
1069195072 10:65541672-65541694 AGAAAGTTCTGGAAGAAAGTGGG - Intergenic
1069195072 10:65541672-65541694 AGAAAGTTCTGGAAGAAAGTGGG - Intergenic
1071415285 10:85435627-85435649 CTCCAGTTCATGAAGAAAGTGGG + Intergenic
1071415285 10:85435627-85435649 CTCCAGTTCATGAAGAAAGTGGG + Intergenic
1072065644 10:91868586-91868608 CTATAGATCCTGAGGAAAGGAGG + Intergenic
1072065644 10:91868586-91868608 CTATAGATCCTGAGGAAAGGAGG + Intergenic
1073309219 10:102527825-102527847 CCAGAGTTCTGGAGGAGAGTGGG + Intronic
1073309219 10:102527825-102527847 CCAGAGTTCTGGAGGAGAGTGGG + Intronic
1075921809 10:126219663-126219685 CTAAACTTTGTGAGAAAAGTTGG - Intronic
1075921809 10:126219663-126219685 CTAAACTTTGTGAGAAAAGTTGG - Intronic
1081414577 11:42798948-42798970 CTAAAGTTCTAGAAGAAAACCGG - Intergenic
1081414577 11:42798948-42798970 CTAAAGTTCTAGAAGAAAACCGG - Intergenic
1083037728 11:59655897-59655919 CTAATGAACTTTAGGAAAGTAGG + Intronic
1083037728 11:59655897-59655919 CTAATGAACTTTAGGAAAGTAGG + Intronic
1083109123 11:60387688-60387710 CTAAAGTTGTTGAGGAAGCCAGG - Intronic
1083109123 11:60387688-60387710 CTAAAGTTGTTGAGGAAGCCAGG - Intronic
1083764330 11:64834877-64834899 CTGGAGTCCTTGAGGAACGTAGG - Exonic
1083764330 11:64834877-64834899 CTGGAGTCCTTGAGGAACGTAGG - Exonic
1085979347 11:81704696-81704718 CTCAATTTCTTGTTGAAAGTAGG + Intergenic
1085979347 11:81704696-81704718 CTCAATTTCTTGTTGAAAGTAGG + Intergenic
1087165392 11:94998124-94998146 CTACAGTTCTCAAGGAAAATGGG + Exonic
1087165392 11:94998124-94998146 CTACAGTTCTCAAGGAAAATGGG + Exonic
1087168392 11:95026300-95026322 CTACAGTTCTCAAGGAAAATGGG + Exonic
1087168392 11:95026300-95026322 CTACAGTTCTCAAGGAAAATGGG + Exonic
1087678735 11:101193647-101193669 CTAATGTTCTTGAGAAAATGTGG + Intergenic
1087678735 11:101193647-101193669 CTAATGTTCTTGAGAAAATGTGG + Intergenic
1087922988 11:103888195-103888217 CTCAAGGTTTTGTGGAAAGTTGG + Intergenic
1087922988 11:103888195-103888217 CTCAAGGTTTTGTGGAAAGTTGG + Intergenic
1089414892 11:118279909-118279931 CTAAAGTAGATGAGGAAAATTGG - Intergenic
1089414892 11:118279909-118279931 CTAAAGTAGATGAGGAAAATTGG - Intergenic
1090504929 11:127300834-127300856 ATAAAGTTTAAGAGGAAAGTAGG - Intergenic
1090504929 11:127300834-127300856 ATAAAGTTTAAGAGGAAAGTAGG - Intergenic
1092763205 12:11827987-11828009 CGAAACTGCTGGAGGAAAGTTGG - Intronic
1092763205 12:11827987-11828009 CGAAACTGCTGGAGGAAAGTTGG - Intronic
1092841259 12:12543292-12543314 CTGATGTGCTTGAGGATAGTGGG + Intronic
1092841259 12:12543292-12543314 CTGATGTGCTTGAGGATAGTGGG + Intronic
1094337673 12:29378990-29379012 TTAAAGTCTTTGAGGAAAGTGGG + Intronic
1094337673 12:29378990-29379012 TTAAAGTCTTTGAGGAAAGTGGG + Intronic
1095537942 12:43274222-43274244 CTATAGTTCTTCAGGAAAATTGG - Intergenic
1095537942 12:43274222-43274244 CTATAGTTCTTCAGGAAAATTGG - Intergenic
1100555937 12:95694022-95694044 CTAGAGTTCTAGTGGAAGGTGGG - Intronic
1100555937 12:95694022-95694044 CTAGAGTTCTAGTGGAAGGTGGG - Intronic
1101642701 12:106600003-106600025 ATAAAGTTTTTGAGTAGAGTGGG - Intronic
1101642701 12:106600003-106600025 ATAAAGTTTTTGAGTAGAGTGGG - Intronic
1104065868 12:125305354-125305376 CTAAAGTTCTGATGGGAAGTGGG + Intronic
1104065868 12:125305354-125305376 CTAAAGTTCTGATGGGAAGTGGG + Intronic
1105942279 13:25158551-25158573 CTTAAGTTCTTCAGGACAGTGGG - Intergenic
1105942279 13:25158551-25158573 CTTAAGTTCTTCAGGACAGTGGG - Intergenic
1106369025 13:29113349-29113371 CTCTAATTCTTGAGGCAAGTGGG - Intronic
1106369025 13:29113349-29113371 CTCTAATTCTTGAGGCAAGTGGG - Intronic
1106653445 13:31716959-31716981 CTATAGTATATGAGGAAAGTGGG + Intergenic
1106653445 13:31716959-31716981 CTATAGTATATGAGGAAAGTGGG + Intergenic
1107187453 13:37540774-37540796 CTAAAATTTTTTAGGAAAGATGG + Intergenic
1107187453 13:37540774-37540796 CTAAAATTTTTTAGGAAAGATGG + Intergenic
1108911950 13:55565127-55565149 CTCCAGTTGTTGAGGTAAGTGGG - Intergenic
1108911950 13:55565127-55565149 CTCCAGTTGTTGAGGTAAGTGGG - Intergenic
1109241663 13:59897441-59897463 ATATAGTTCTTAAGGAAAGTGGG + Intronic
1109241663 13:59897441-59897463 ATATAGTTCTTAAGGAAAGTGGG + Intronic
1110492833 13:76128997-76129019 CTGAAGTTCATGAGCAAATTAGG + Intergenic
1110492833 13:76128997-76129019 CTGAAGTTCATGAGCAAATTAGG + Intergenic
1111285926 13:86091689-86091711 CCAAAGGTCTAGAGGCAAGTTGG + Intergenic
1111285926 13:86091689-86091711 CCAAAGGTCTAGAGGCAAGTTGG + Intergenic
1111694791 13:91609714-91609736 CCAAAGTTGTAGAGCAAAGTGGG - Intronic
1111694791 13:91609714-91609736 CCAAAGTTGTAGAGCAAAGTGGG - Intronic
1112020375 13:95366279-95366301 CTAAAGAACTTGAAGAAATTCGG - Intergenic
1112020375 13:95366279-95366301 CTAAAGAACTTGAAGAAATTCGG - Intergenic
1113266788 13:108627668-108627690 CTTAAGTTATTGAAAAAAGTAGG + Intronic
1113266788 13:108627668-108627690 CTTAAGTTATTGAAAAAAGTAGG + Intronic
1115355335 14:32440587-32440609 TCAAAGATCTTGAAGAAAGTTGG - Intronic
1115355335 14:32440587-32440609 TCAAAGATCTTGAAGAAAGTTGG - Intronic
1116321145 14:43464866-43464888 TTAAAGTTTTTGAAGAAAATGGG - Intergenic
1116321145 14:43464866-43464888 TTAAAGTTTTTGAAGAAAATGGG - Intergenic
1118198100 14:63646967-63646989 CTCAAGTTTTTGAAGAAAATAGG - Intergenic
1118198100 14:63646967-63646989 CTCAAGTTTTTGAAGAAAATAGG - Intergenic
1119119690 14:72063126-72063148 ATGAAATTCTTGAGGAAAGGAGG + Intronic
1119119690 14:72063126-72063148 ATGAAATTCTTGAGGAAAGGAGG + Intronic
1120129605 14:80789564-80789586 CTAAAATCCTTGAGAAATGTAGG + Intronic
1120129605 14:80789564-80789586 CTAAAATCCTTGAGAAATGTAGG + Intronic
1120278367 14:82407672-82407694 CTATAATTTTTGTGGAAAGTGGG + Intergenic
1120278367 14:82407672-82407694 CTATAATTTTTGTGGAAAGTGGG + Intergenic
1202840993 14_GL000009v2_random:121160-121182 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1202840993 14_GL000009v2_random:121160-121182 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1202910378 14_GL000194v1_random:111388-111410 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1202910378 14_GL000194v1_random:111388-111410 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1202882201 14_KI270722v1_random:71108-71130 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1202882201 14_KI270722v1_random:71108-71130 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1126405613 15:48319695-48319717 CTAGTGTTCTTGGGGAAAGTGGG + Intergenic
1126405613 15:48319695-48319717 CTAGTGTTCTTGGGGAAAGTGGG + Intergenic
1127680819 15:61296184-61296206 CTAAAGATGTTGAGGGAAGAAGG - Intergenic
1127680819 15:61296184-61296206 CTAAAGATGTTGAGGGAAGAAGG - Intergenic
1129821512 15:78605247-78605269 CTAAATTTCTTCAGAAAAATAGG + Intronic
1129821512 15:78605247-78605269 CTAAATTTCTTCAGAAAAATAGG + Intronic
1130290511 15:82596048-82596070 ATAAATTTTTTGAGAAAAGTAGG - Intronic
1130290511 15:82596048-82596070 ATAAATTTTTTGAGAAAAGTAGG - Intronic
1133662312 16:7930249-7930271 CTAAAGGTATTGAAAAAAGTTGG + Intergenic
1133662312 16:7930249-7930271 CTAAAGGTATTGAAAAAAGTTGG + Intergenic
1137005009 16:35268049-35268071 GTTAAGTCCTTGAGGAAGGTGGG + Intergenic
1137005009 16:35268049-35268071 GTTAAGTCCTTGAGGAAGGTGGG + Intergenic
1138094346 16:54200346-54200368 CTAATGTGCTTGGGGAAGGTAGG - Intergenic
1138094346 16:54200346-54200368 CTAATGTGCTTGGGGAAGGTAGG - Intergenic
1139209695 16:65065173-65065195 CTAAAGCCCTACAGGAAAGTAGG + Intronic
1139209695 16:65065173-65065195 CTAAAGCCCTACAGGAAAGTAGG + Intronic
1146688989 17:34860105-34860127 CCAAACTCCTTGAGGACAGTGGG + Intergenic
1146688989 17:34860105-34860127 CCAAACTCCTTGAGGACAGTGGG + Intergenic
1147652879 17:42072192-42072214 CTAAACTTCTTAAGAAAAGACGG + Intergenic
1147652879 17:42072192-42072214 CTAAACTTCTTAAGAAAAGACGG + Intergenic
1148706324 17:49636292-49636314 GAAAAGTTCTTCAGGAAGGTCGG - Intronic
1148706324 17:49636292-49636314 GAAAAGTTCTTCAGGAAGGTCGG - Intronic
1152379676 17:79935880-79935902 CAAAAGTGCTGGAGGAAAGATGG + Exonic
1152379676 17:79935880-79935902 CAAAAGTGCTGGAGGAAAGATGG + Exonic
1157011218 18:43651530-43651552 CAAAAGATCTTGATGAAAATGGG - Intergenic
1157011218 18:43651530-43651552 CAAAAGATCTTGATGAAAATGGG - Intergenic
1157557540 18:48622499-48622521 GAAAAGTCCTTGAGGAATGTGGG + Intronic
1157557540 18:48622499-48622521 GAAAAGTCCTTGAGGAATGTGGG + Intronic
1157949053 18:52013919-52013941 ATAAAGTTCCAGAGGAAAGAAGG - Intergenic
1157949053 18:52013919-52013941 ATAAAGTTCCAGAGGAAAGAAGG - Intergenic
1161837290 19:6656521-6656543 CTTAAGTCCTTGAGGAAGGGGGG + Intergenic
1161837290 19:6656521-6656543 CTTAAGTCCTTGAGGAAGGGGGG + Intergenic
1161838125 19:6661602-6661624 CTTAAGTCCTTGAGGAAGGGGGG + Intronic
1161838125 19:6661602-6661624 CTTAAGTCCTTGAGGAAGGGGGG + Intronic
1162463336 19:10826298-10826320 CCCAAGTTCCTTAGGAAAGTGGG + Intronic
1162463336 19:10826298-10826320 CCCAAGTTCCTTAGGAAAGTGGG + Intronic
1162494452 19:11015632-11015654 CTGAAATTATTGAGGAAAGTAGG - Intronic
1162494452 19:11015632-11015654 CTGAAATTATTGAGGAAAGTAGG - Intronic
1165475081 19:36025850-36025872 TTCAAGGTCATGAGGAAAGTTGG - Intronic
1165475081 19:36025850-36025872 TTCAAGGTCATGAGGAAAGTTGG - Intronic
1168488039 19:56781596-56781618 CTAAAGTACTTGTCGAAAGCTGG - Intronic
1168488039 19:56781596-56781618 CTAAAGTACTTGTCGAAAGCTGG - Intronic
1202631318 1_KI270706v1_random:2610-2632 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1202631318 1_KI270706v1_random:2610-2632 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1202657811 1_KI270708v1_random:40206-40228 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1202657811 1_KI270708v1_random:40206-40228 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
928763018 2:34606701-34606723 CTATAGTTCTTGATGAATATGGG + Intergenic
928763018 2:34606701-34606723 CTATAGTTCTTGATGAATATGGG + Intergenic
929085203 2:38161161-38161183 CTTCAGTTCTGGAGGAAAGCTGG + Intergenic
929085203 2:38161161-38161183 CTTCAGTTCTGGAGGAAAGCTGG + Intergenic
930174691 2:48289782-48289804 CTAAAGTTGTTTGGGAAAGGAGG + Intergenic
930174691 2:48289782-48289804 CTAAAGTTGTTTGGGAAAGGAGG + Intergenic
930512833 2:52367255-52367277 CTAAAATCCTTGAGAAAATTAGG - Intergenic
930512833 2:52367255-52367277 CTAAAATCCTTGAGAAAATTAGG - Intergenic
930544973 2:52755876-52755898 CTATAGTTCTGGAAGAAATTTGG + Intergenic
930544973 2:52755876-52755898 CTATAGTTCTGGAAGAAATTTGG + Intergenic
930672545 2:54166361-54166383 CTCAAGGACTTGAGGAAAGATGG + Intronic
930672545 2:54166361-54166383 CTCAAGGACTTGAGGAAAGATGG + Intronic
930682800 2:54275083-54275105 CCAAAGTTATTGAGGCAAGGAGG - Intronic
930682800 2:54275083-54275105 CCAAAGTTATTGAGGCAAGGAGG - Intronic
932641627 2:73453294-73453316 CTAAAACTCTTAAGGAAATTCGG + Exonic
932641627 2:73453294-73453316 CTAAAACTCTTAAGGAAATTCGG + Exonic
934175560 2:89576435-89576457 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
934175560 2:89576435-89576457 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
934285876 2:91650799-91650821 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
934285876 2:91650799-91650821 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
937795802 2:126018892-126018914 CTTAAGGTCTAGAGGAAAGATGG - Intergenic
937795802 2:126018892-126018914 CTTAAGGTCTAGAGGAAAGATGG - Intergenic
938883658 2:135619177-135619199 CTAAAGAGATTGAGGAAAGAAGG + Intronic
938883658 2:135619177-135619199 CTAAAGAGATTGAGGAAAGAAGG + Intronic
939515693 2:143165319-143165341 CAAAAGTAGTGGAGGAAAGTTGG - Intronic
939515693 2:143165319-143165341 CAAAAGTAGTGGAGGAAAGTTGG - Intronic
940069224 2:149666113-149666135 CTAAAATTCTTGAGGAAAATAGG - Intergenic
940069224 2:149666113-149666135 CTAAAATTCTTGAGGAAAATAGG - Intergenic
941766544 2:169303483-169303505 TTAAAGCTCTTGTGGAAAGTGGG - Intronic
941766544 2:169303483-169303505 TTAAAGCTCTTGTGGAAAGTGGG - Intronic
944573640 2:201070817-201070839 TTAAAGATCTTCAGAAAAGTGGG - Intronic
944573640 2:201070817-201070839 TTAAAGATCTTCAGAAAAGTGGG - Intronic
945785361 2:214228165-214228187 ACTAAGTTCTTAAGGAAAGTAGG - Intronic
945785361 2:214228165-214228187 ACTAAGTTCTTAAGGAAAGTAGG - Intronic
948533445 2:238628839-238628861 CTAAAGCTCTTGTGGAAACAGGG + Intergenic
948533445 2:238628839-238628861 CTAAAGCTCTTGTGGAAACAGGG + Intergenic
948606709 2:239140616-239140638 CTAGAGTTCTCGAGGCAAATGGG - Intronic
948606709 2:239140616-239140638 CTAGAGTTCTCGAGGCAAATGGG - Intronic
1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG + Intergenic
1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG + Intergenic
1169030492 20:2403290-2403312 CCACAGTTCTTGTGGAAAGTAGG + Intronic
1169030492 20:2403290-2403312 CCACAGTTCTTGTGGAAAGTAGG + Intronic
1170311906 20:15001434-15001456 CTAAAGTTTTAGAGGAAAGCTGG - Intronic
1170311906 20:15001434-15001456 CTAAAGTTTTAGAGGAAAGCTGG - Intronic
1172374028 20:34421473-34421495 CAAATTTTCTTGAGGAAATTTGG + Intronic
1172374028 20:34421473-34421495 CAAATTTTCTTGAGGAAATTTGG + Intronic
1173126199 20:40338385-40338407 CTACAGATCTGGAGGAAATTAGG + Intergenic
1173126199 20:40338385-40338407 CTACAGATCTGGAGGAAATTAGG + Intergenic
1173434530 20:43020880-43020902 CTAAAGTTCTTCAGTAAAATAGG - Intronic
1173434530 20:43020880-43020902 CTAAAGTTCTTCAGTAAAATAGG - Intronic
1174671932 20:52316529-52316551 TTAAAGTTGTTGAGAAAAGAGGG + Intergenic
1174671932 20:52316529-52316551 TTAAAGTTGTTGAGAAAAGAGGG + Intergenic
1176597702 21:8762548-8762570 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1176597702 21:8762548-8762570 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1176629734 21:9126089-9126111 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1176629734 21:9126089-9126111 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1176643537 21:9328550-9328572 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1176643537 21:9328550-9328572 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1176911433 21:14569878-14569900 CTAAATTTCTTGCAGATAGTAGG + Intronic
1176911433 21:14569878-14569900 CTAAATTTCTTGCAGATAGTAGG + Intronic
1177264984 21:18770963-18770985 CAAAAGTTCTTGAATAAACTTGG + Intergenic
1177264984 21:18770963-18770985 CAAAAGTTCTTGAATAAACTTGG + Intergenic
1180120430 21:45742905-45742927 CTAAAGTTCATTTAGAAAGTAGG - Intronic
1180120430 21:45742905-45742927 CTAAAGTTCATTTAGAAAGTAGG - Intronic
1180369396 22:11970671-11970693 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1180369396 22:11970671-11970693 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1180376835 22:12101444-12101466 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1180376835 22:12101444-12101466 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1180420738 22:12812248-12812270 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1180420738 22:12812248-12812270 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1182105298 22:27684933-27684955 TGAAAATTCTTGAGAAAAGTAGG + Intergenic
1182105298 22:27684933-27684955 TGAAAATTCTTGAGAAAAGTAGG + Intergenic
1184549446 22:45196737-45196759 CACATGTTCTTGAGGAAAGCCGG - Exonic
1184549446 22:45196737-45196759 CACATGTTCTTGAGGAAAGCCGG - Exonic
1185078551 22:48696421-48696443 TCAAAGTTCCTGAGGAAAGGAGG - Intronic
1185078551 22:48696421-48696443 TCAAAGTTCCTGAGGAAAGGAGG - Intronic
949198909 3:1347441-1347463 CTAAACTTATTGAGGAAATAAGG + Intronic
949198909 3:1347441-1347463 CTAAACTTATTGAGGAAATAAGG + Intronic
951596331 3:24322353-24322375 TTAAAGTTCCTGGGAAAAGTAGG + Intronic
951596331 3:24322353-24322375 TTAAAGTTCCTGGGAAAAGTAGG + Intronic
952037746 3:29222988-29223010 GTAGAGTTCTCCAGGAAAGTAGG - Intergenic
952037746 3:29222988-29223010 GTAGAGTTCTCCAGGAAAGTAGG - Intergenic
952622273 3:35360105-35360127 CTAAATTTGTTGAGGTAACTTGG + Intergenic
952622273 3:35360105-35360127 CTAAATTTGTTGAGGTAACTTGG + Intergenic
953502960 3:43455501-43455523 CTTAAGTCCTTGAGGAATGGGGG + Intronic
953502960 3:43455501-43455523 CTTAAGTCCTTGAGGAATGGGGG + Intronic
955580267 3:60412268-60412290 ATAAAAATCTTGAGGAAGGTGGG + Intronic
955580267 3:60412268-60412290 ATAAAAATCTTGAGGAAGGTGGG + Intronic
955650895 3:61192726-61192748 CTAAAGATTTTGGGGAATGTGGG - Intronic
955650895 3:61192726-61192748 CTAAAGATTTTGGGGAATGTGGG - Intronic
955716052 3:61831050-61831072 CTCAAGTTTTTGAGGAATATCGG + Intronic
955716052 3:61831050-61831072 CTCAAGTTTTTGAGGAATATCGG + Intronic
955852990 3:63241139-63241161 CTAATGCTCTTGAGCAAGGTGGG - Intronic
955852990 3:63241139-63241161 CTAATGCTCTTGAGCAAGGTGGG - Intronic
955943382 3:64167983-64168005 CTAGATCTCTTGAAGAAAGTGGG - Intronic
955943382 3:64167983-64168005 CTAGATCTCTTGAAGAAAGTGGG - Intronic
957729758 3:84118639-84118661 GTAAAGTCCTTGAGGAAGGAGGG + Intergenic
957729758 3:84118639-84118661 GTAAAGTCCTTGAGGAAGGAGGG + Intergenic
958029331 3:88088534-88088556 TTAAAGTTCTGTAGGAAGGTTGG + Intronic
958029331 3:88088534-88088556 TTAAAGTTCTGTAGGAAGGTTGG + Intronic
960395541 3:117132410-117132432 TCAAAGTTTTTGAGGAAAATTGG + Intronic
960395541 3:117132410-117132432 TCAAAGTTTTTGAGGAAAATTGG + Intronic
960551640 3:118982343-118982365 ATTAAGTTTTTGAGGAAAGGAGG - Intronic
960551640 3:118982343-118982365 ATTAAGTTTTTGAGGAAAGGAGG - Intronic
961373088 3:126443677-126443699 GTAAAATTCTGGAGGTAAGTGGG - Intronic
961373088 3:126443677-126443699 GTAAAATTCTGGAGGTAAGTGGG - Intronic
962508965 3:136079348-136079370 ATAATGTGCTTCAGGAAAGTGGG - Intronic
962508965 3:136079348-136079370 ATAATGTGCTTCAGGAAAGTGGG - Intronic
962709900 3:138077554-138077576 CTGAAGTGCTTCAGCAAAGTGGG + Exonic
962709900 3:138077554-138077576 CTGAAGTGCTTCAGCAAAGTGGG + Exonic
964425424 3:156548060-156548082 ACAAAGTTCTGGAGCAAAGTGGG + Intronic
964425424 3:156548060-156548082 ACAAAGTTCTGGAGCAAAGTGGG + Intronic
965064797 3:163832722-163832744 CGAAAGTTCTTGGGAGAAGTTGG + Intergenic
965064797 3:163832722-163832744 CGAAAGTTCTTGGGAGAAGTTGG + Intergenic
965722857 3:171680642-171680664 TTAAAGTTCTGGAGGGAACTAGG - Intronic
965722857 3:171680642-171680664 TTAAAGTTCTGGAGGGAACTAGG - Intronic
965917841 3:173872706-173872728 CTAAAATCCTTGAAGCAAGTCGG - Intronic
965917841 3:173872706-173872728 CTAAAATCCTTGAAGCAAGTCGG - Intronic
966471147 3:180290632-180290654 CTAAAATAATAGAGGAAAGTGGG + Intergenic
966471147 3:180290632-180290654 CTAAAATAATAGAGGAAAGTGGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
1202743345 3_GL000221v1_random:76479-76501 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1202743345 3_GL000221v1_random:76479-76501 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
970294297 4:14612031-14612053 CTAAAGTTCCTGTCCAAAGTTGG + Intergenic
970294297 4:14612031-14612053 CTAAAGTTCCTGTCCAAAGTTGG + Intergenic
972719446 4:41681524-41681546 CTACAGGTCTTGTGGAATGTGGG - Intronic
972719446 4:41681524-41681546 CTACAGGTCTTGTGGAATGTGGG - Intronic
973361004 4:49164802-49164824 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
973361004 4:49164802-49164824 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
974586406 4:63884657-63884679 CTAAACTTCTTAAGCAAAGAAGG + Intergenic
974586406 4:63884657-63884679 CTAAACTTCTTAAGCAAAGAAGG + Intergenic
975645757 4:76544370-76544392 TAAAATTTTTTGAGGAAAGTGGG - Intronic
975645757 4:76544370-76544392 TAAAATTTTTTGAGGAAAGTGGG - Intronic
976380465 4:84392896-84392918 CTAAATTCCCTGAGGCAAGTAGG - Intergenic
976380465 4:84392896-84392918 CTAAATTCCCTGAGGCAAGTAGG - Intergenic
977211835 4:94227187-94227209 CTGGTGTTTTTGAGGAAAGTGGG + Intronic
977211835 4:94227187-94227209 CTGGTGTTTTTGAGGAAAGTGGG + Intronic
978304430 4:107309595-107309617 CTAAAATACTTAAGGAAAATAGG - Intergenic
978304430 4:107309595-107309617 CTAAAATACTTAAGGAAAATAGG - Intergenic
980551898 4:134347544-134347566 ATAAAGTTCTAGAGTAGAGTAGG + Intergenic
980551898 4:134347544-134347566 ATAAAGTTCTAGAGTAGAGTAGG + Intergenic
981764250 4:148229854-148229876 CTAGAGTTCTTTAGGGAAGGGGG - Intronic
981764250 4:148229854-148229876 CTAGAGTTCTTTAGGGAAGGGGG - Intronic
984012417 4:174386011-174386033 CTACAGTTCAAGAGGAAATTTGG + Intergenic
984012417 4:174386011-174386033 CTACAGTTCAAGAGGAAATTTGG + Intergenic
985051560 4:185997289-185997311 CTAAAATTTTTCAGGAATGTAGG - Intergenic
985051560 4:185997289-185997311 CTAAAATTTTTCAGGAATGTAGG - Intergenic
1202758434 4_GL000008v2_random:86877-86899 TTAAAGTCCTTGAGGAAAAGGGG + Intergenic
1202758434 4_GL000008v2_random:86877-86899 TTAAAGTCCTTGAGGAAAAGGGG + Intergenic
987279854 5:16401917-16401939 CTAAGGTTATTGATGAATGTGGG - Intergenic
987279854 5:16401917-16401939 CTAAGGTTATTGATGAATGTGGG - Intergenic
988731375 5:33976355-33976377 ATAAACTTCTTGAGGGAAGGGGG - Intronic
988731375 5:33976355-33976377 ATAAACTTCTTGAGGGAAGGGGG - Intronic
988981527 5:36574461-36574483 GTAAAGTGCTTGTGGAAAGCAGG + Intergenic
988981527 5:36574461-36574483 GTAAAGTGCTTGTGGAAAGCAGG + Intergenic
989417501 5:41197083-41197105 CTAAAATTCTTGGGAAAATTGGG + Intronic
989417501 5:41197083-41197105 CTAAAATTCTTGGGAAAATTGGG + Intronic
989979346 5:50624281-50624303 ATTAGGTTCATGAGGAAAGTTGG + Intergenic
989979346 5:50624281-50624303 ATTAGGTTCATGAGGAAAGTTGG + Intergenic
990067297 5:51734094-51734116 ATAAAGGGCTTGAGGAATGTGGG + Intergenic
990067297 5:51734094-51734116 ATAAAGGGCTTGAGGAATGTGGG + Intergenic
990475522 5:56158528-56158550 ACAAAGTTCTTGAGGGAAGGTGG - Intronic
990475522 5:56158528-56158550 ACAAAGTTCTTGAGGGAAGGTGG - Intronic
990929098 5:61067012-61067034 CTAATGTTCATGAGGACTGTTGG + Intronic
990929098 5:61067012-61067034 CTAATGTTCATGAGGACTGTTGG + Intronic
991423278 5:66463655-66463677 CTAGAGTTCTTGATGACATTAGG + Intergenic
991423278 5:66463655-66463677 CTAGAGTTCTTGATGACATTAGG + Intergenic
996309930 5:122093121-122093143 CCAAAGTTCTAGTGGAAACTTGG + Intergenic
996309930 5:122093121-122093143 CCAAAGTTCTAGTGGAAACTTGG + Intergenic
996817623 5:127591141-127591163 TTAAAATTATTGATGAAAGTAGG - Intergenic
996817623 5:127591141-127591163 TTAAAATTATTGATGAAAGTAGG - Intergenic
998810449 5:145961117-145961139 ATAACGTTCTTGAAGACAGTGGG + Intronic
998810449 5:145961117-145961139 ATAACGTTCTTGAAGACAGTGGG + Intronic
999038098 5:148376034-148376056 TTAAAGTGCTTGAGGAATGAAGG - Intergenic
999038098 5:148376034-148376056 TTAAAGTGCTTGAGGAATGAAGG - Intergenic
1000110250 5:158101358-158101380 CTCATGGTCTAGAGGAAAGTAGG + Intergenic
1000110250 5:158101358-158101380 CTCATGGTCTAGAGGAAAGTAGG + Intergenic
1002496131 5:179612852-179612874 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1002496131 5:179612852-179612874 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1003272225 6:4617346-4617368 CTACAGTTCTTGAGAGAAGGAGG - Intergenic
1003272225 6:4617346-4617368 CTACAGTTCTTGAGAGAAGGAGG - Intergenic
1005103299 6:22197281-22197303 CTAAAGTTGTTGAGGATAGTAGG - Intergenic
1005103299 6:22197281-22197303 CTAAAGTTGTTGAGGATAGTAGG - Intergenic
1005392842 6:25350671-25350693 TTAAAGTTCTTGAGGAGAGAGGG + Intronic
1005392842 6:25350671-25350693 TTAAAGTTCTTGAGGAGAGAGGG + Intronic
1006411146 6:33874193-33874215 ATGAAGGTCTTGAGAAAAGTGGG - Intergenic
1006411146 6:33874193-33874215 ATGAAGGTCTTGAGAAAAGTGGG - Intergenic
1007739256 6:44000968-44000990 CCAAAGTTGTTGAGGAAGGAGGG + Intronic
1007739256 6:44000968-44000990 CCAAAGTTGTTGAGGAAGGAGGG + Intronic
1008014398 6:46502212-46502234 TTAAACTTCTTGAGAAAAATTGG - Intergenic
1008014398 6:46502212-46502234 TTAAACTTCTTGAGAAAAATTGG - Intergenic
1008532367 6:52475212-52475234 CAAAAGTTCTTGAGGAAGAAAGG + Intronic
1008532367 6:52475212-52475234 CAAAAGTTCTTGAGGAAGAAAGG + Intronic
1011859852 6:91740933-91740955 CTCAATTTCTTGAGAAATGTAGG - Intergenic
1011859852 6:91740933-91740955 CTCAATTTCTTGAGAAATGTAGG - Intergenic
1013942723 6:115684293-115684315 CTAATGTTCTTGAAGAAGATAGG - Intergenic
1013942723 6:115684293-115684315 CTAATGTTCTTGAAGAAGATAGG - Intergenic
1015080289 6:129216769-129216791 CTTAAGTTCTTGAGAATAGTTGG + Intronic
1015080289 6:129216769-129216791 CTTAAGTTCTTGAGAATAGTTGG + Intronic
1015527216 6:134185174-134185196 CTAAAGTTCTTGAGGAAAGTTGG - Intronic
1015527216 6:134185174-134185196 CTAAAGTTCTTGAGGAAAGTTGG - Intronic
1017023959 6:150165440-150165462 CTAAAGTCCTTGGGGAAGGCTGG + Intronic
1017023959 6:150165440-150165462 CTAAAGTCCTTGGGGAAGGCTGG + Intronic
1017071565 6:150579613-150579635 ATAAAATCTTTGAGGAAAGTTGG - Intergenic
1017071565 6:150579613-150579635 ATAAAATCTTTGAGGAAAGTTGG - Intergenic
1017741364 6:157409564-157409586 GTCAAGCTCTTGAGTAAAGTAGG + Intronic
1017741364 6:157409564-157409586 GTCAAGCTCTTGAGTAAAGTAGG + Intronic
1018757172 6:166860332-166860354 GTAAAGGTTTTGAGGAAAATTGG - Intronic
1018757172 6:166860332-166860354 GTAAAGGTTTTGAGGAAAATTGG - Intronic
1021377870 7:19931162-19931184 CTAAAGTTAATGAGGAAACTTGG - Intergenic
1021377870 7:19931162-19931184 CTAAAGTTAATGAGGAAACTTGG - Intergenic
1022334448 7:29409057-29409079 CTATAAAACTTGAGGAAAGTGGG - Intronic
1022334448 7:29409057-29409079 CTATAAAACTTGAGGAAAGTGGG - Intronic
1027702809 7:81488941-81488963 CTAAAGTTTCTGAGGTATGTTGG + Intergenic
1027702809 7:81488941-81488963 CTAAAGTTTCTGAGGTATGTTGG + Intergenic
1029033807 7:97496959-97496981 ATAAAATACTTGAGGAAAGTAGG + Intergenic
1029033807 7:97496959-97496981 ATAAAATACTTGAGGAAAGTAGG + Intergenic
1030204585 7:106940599-106940621 CTGAAGCTTTAGAGGAAAGTGGG - Intergenic
1030204585 7:106940599-106940621 CTGAAGCTTTAGAGGAAAGTGGG - Intergenic
1030897036 7:115073387-115073409 CGGAGGTTTTTGAGGAAAGTTGG - Intergenic
1030897036 7:115073387-115073409 CGGAGGTTTTTGAGGAAAGTTGG - Intergenic
1031152814 7:118074131-118074153 CTAAATGACTTGAGGAAAGCTGG + Intergenic
1031152814 7:118074131-118074153 CTAAATGACTTGAGGAAAGCTGG + Intergenic
1034604439 7:152298496-152298518 CTAAAGTTCTAGAAGAAAAAAGG + Intronic
1034604439 7:152298496-152298518 CTAAAGTTCTAGAAGAAAAAAGG + Intronic
1036484694 8:9169031-9169053 TTGAAGTTCTTGGGGAATGTCGG - Intergenic
1036484694 8:9169031-9169053 TTGAAGTTCTTGGGGAATGTCGG - Intergenic
1036985396 8:13523008-13523030 CTCAAGTTGTTAAGGAAAGAAGG + Intergenic
1036985396 8:13523008-13523030 CTCAAGTTGTTAAGGAAAGAAGG + Intergenic
1038881877 8:31623576-31623598 CTCAAGTCCATGAGGGAAGTAGG - Intergenic
1038881877 8:31623576-31623598 CTCAAGTCCATGAGGGAAGTAGG - Intergenic
1039341419 8:36654301-36654323 CTAAAGTTCACTAGGAAAGAAGG + Intergenic
1039341419 8:36654301-36654323 CTAAAGTTCACTAGGAAAGAAGG + Intergenic
1041170938 8:55141453-55141475 CTAAAGTCCCTGAGGAAGATGGG - Intronic
1041170938 8:55141453-55141475 CTAAAGTCCCTGAGGAAGATGGG - Intronic
1042516123 8:69661454-69661476 CTAAATTTCTTCAGGAGATTTGG - Intergenic
1042516123 8:69661454-69661476 CTAAATTTCTTCAGGAGATTTGG - Intergenic
1042676629 8:71328733-71328755 CTAAAGTTTTTGATAAATGTAGG - Intronic
1042676629 8:71328733-71328755 CTAAAGTTTTTGATAAATGTAGG - Intronic
1043047336 8:75343112-75343134 TTCAAGTTATTGAGGAAAGGGGG - Intergenic
1043047336 8:75343112-75343134 TTCAAGTTATTGAGGAAAGGGGG - Intergenic
1043641841 8:82462484-82462506 CTAAAGTTCGGTAAGAAAGTTGG + Intergenic
1043641841 8:82462484-82462506 CTAAAGTTCGGTAAGAAAGTTGG + Intergenic
1044741507 8:95332138-95332160 ACTAAGTTCTTGGGGAAAGTTGG + Intergenic
1044741507 8:95332138-95332160 ACTAAGTTCTTGGGGAAAGTTGG + Intergenic
1044987035 8:97764942-97764964 GTATATTTCCTGAGGAAAGTGGG - Intergenic
1044987035 8:97764942-97764964 GTATATTTCCTGAGGAAAGTGGG - Intergenic
1045623279 8:104008554-104008576 CTAATTTTCTTGAGGAAATTGGG + Intronic
1045623279 8:104008554-104008576 CTAATTTTCTTGAGGAAATTGGG + Intronic
1046089622 8:109485574-109485596 CTATAATTGTTGAGGAAAGAAGG + Intronic
1046089622 8:109485574-109485596 CTATAATTGTTGAGGAAAGAAGG + Intronic
1046526545 8:115388350-115388372 CTGAAGCTCTTGAGGACATTCGG - Intergenic
1046526545 8:115388350-115388372 CTGAAGCTCTTGAGGACATTCGG - Intergenic
1047408788 8:124607226-124607248 TTAAAGTTCTAGAGGAAAAGTGG + Intronic
1047408788 8:124607226-124607248 TTAAAGTTCTAGAGGAAAAGTGG + Intronic
1049834731 8:144727786-144727808 GTAAAGTTCTTGAAGGAAATTGG - Intronic
1049834731 8:144727786-144727808 GTAAAGTTCTTGAAGGAAATTGG - Intronic
1051525511 9:18038734-18038756 CTAAACTTCATGTGAAAAGTTGG - Intergenic
1051525511 9:18038734-18038756 CTAAACTTCATGTGAAAAGTTGG - Intergenic
1051538771 9:18190968-18190990 CTAGATTTCTTGTGGAAATTTGG - Intergenic
1051538771 9:18190968-18190990 CTAGATTTCTTGTGGAAATTTGG - Intergenic
1053278292 9:36799656-36799678 CTGGAGTCCTTGAGGACAGTGGG + Intergenic
1053278292 9:36799656-36799678 CTGGAGTCCTTGAGGACAGTGGG + Intergenic
1053559776 9:39179153-39179175 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1053559776 9:39179153-39179175 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1053823887 9:41999397-41999419 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1053823887 9:41999397-41999419 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1054137340 9:61439790-61439812 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1054137340 9:61439790-61439812 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1054606685 9:67187970-67187992 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1054606685 9:67187970-67187992 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1054736440 9:68755720-68755742 CTAAAGTTATTTAGGCTAGTTGG + Intronic
1054736440 9:68755720-68755742 CTAAAGTTATTTAGGCTAGTTGG + Intronic
1054858735 9:69928293-69928315 CTATTCTTCTTGAGGAAGGTGGG + Intergenic
1054858735 9:69928293-69928315 CTATTCTTCTTGAGGAAGGTGGG + Intergenic
1056170020 9:83975976-83975998 CTGAAATTCTTGAGGAAATGGGG + Intronic
1056170020 9:83975976-83975998 CTGAAATTCTTGAGGAAATGGGG + Intronic
1057621005 9:96634996-96635018 CTAAGGCTCTAGAGTAAAGTAGG - Intergenic
1057621005 9:96634996-96635018 CTAAGGCTCTAGAGTAAAGTAGG - Intergenic
1058029937 9:100184616-100184638 CTACAGTTCTTGAAAATAGTTGG + Intronic
1058029937 9:100184616-100184638 CTACAGTTCTTGAAAATAGTTGG + Intronic
1203690042 Un_GL000214v1:33891-33913 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1203690042 Un_GL000214v1:33891-33913 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1203752568 Un_GL000218v1:93770-93792 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1203752568 Un_GL000218v1:93770-93792 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1203711981 Un_KI270742v1:106443-106465 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1203711981 Un_KI270742v1:106443-106465 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1203539222 Un_KI270743v1:71749-71771 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1203539222 Un_KI270743v1:71749-71771 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1203555590 Un_KI270743v1:204771-204793 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1203555590 Un_KI270743v1:204771-204793 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1203646233 Un_KI270751v1:70162-70184 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1203646233 Un_KI270751v1:70162-70184 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1186662644 X:11684651-11684673 CTTCAGTTATTGAGGAAACTGGG + Intergenic
1186662644 X:11684651-11684673 CTTCAGTTATTGAGGAAACTGGG + Intergenic
1188054736 X:25527845-25527867 CTAAAGTTCAAGAGGAGATTTGG + Intergenic
1188054736 X:25527845-25527867 CTAAAGTTCAAGAGGAGATTTGG + Intergenic
1189808348 X:44757644-44757666 ATAGAGTTTTTCAGGAAAGTTGG + Intergenic
1189808348 X:44757644-44757666 ATAGAGTTTTTCAGGAAAGTTGG + Intergenic
1190639818 X:52473503-52473525 TTGAAGTGCTTAAGGAAAGTTGG - Intergenic
1190639818 X:52473503-52473525 TTGAAGTGCTTAAGGAAAGTTGG - Intergenic
1190647854 X:52539363-52539385 TTGAAGTGCTTAAGGAAAGTTGG + Intergenic
1190647854 X:52539363-52539385 TTGAAGTGCTTAAGGAAAGTTGG + Intergenic
1190650898 X:52567641-52567663 TTACAGTACTTAAGGAAAGTTGG + Intergenic
1190650898 X:52567641-52567663 TTACAGTACTTAAGGAAAGTTGG + Intergenic
1191199719 X:57766747-57766769 CTGAAGTTCTTGGGGATAGATGG - Intergenic
1191199719 X:57766747-57766769 CTGAAGTTCTTGGGGATAGATGG - Intergenic
1194158028 X:90417066-90417088 CTAAAGGTCTTAAGGAAATCAGG + Intergenic
1194158028 X:90417066-90417088 CTAAAGGTCTTAAGGAAATCAGG + Intergenic
1197024793 X:121736277-121736299 CTAAAGTGTTTCAGGAAGGTAGG + Intergenic
1197024793 X:121736277-121736299 CTAAAGTGTTTCAGGAAGGTAGG + Intergenic
1199057489 X:143315530-143315552 CTAAATTTCTTGATGATTGTTGG + Intergenic
1199057489 X:143315530-143315552 CTAAATTTCTTGATGATTGTTGG + Intergenic
1199145086 X:144356000-144356022 GGAAAGTTCTTGAAGAAAATTGG - Intergenic
1199145086 X:144356000-144356022 GGAAAGTTCTTGAAGAAAATTGG - Intergenic
1200504353 Y:3994035-3994057 CTAAAGGTCTTAAGGAAATCAGG + Intergenic
1200504353 Y:3994035-3994057 CTAAAGGTCTTAAGGAAATCAGG + Intergenic
1201166217 Y:11211382-11211404 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1201166217 Y:11211382-11211404 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1202338334 Y:23833124-23833146 TTAAAGTCCTTGAGGAAAAGGGG - Intergenic
1202338334 Y:23833124-23833146 TTAAAGTCCTTGAGGAAAAGGGG - Intergenic
1202532432 Y:25836947-25836969 TTAAAGTCCTTGAGGAAAAGGGG + Intergenic
1202532432 Y:25836947-25836969 TTAAAGTCCTTGAGGAAAAGGGG + Intergenic