ID: 1015532920

View in Genome Browser
Species Human (GRCh38)
Location 6:134239257-134239279
Sequence GTGTATTATCAGAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015532920_1015532924 -8 Left 1015532920 6:134239257-134239279 CCCACTTCCCTCTGATAATACAC 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1015532924 6:134239272-134239294 TAATACACCACCTTCTCAACTGG 0: 1
1: 0
2: 0
3: 8
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015532920 Original CRISPR GTGTATTATCAGAGGGAAGT GGG (reversed) Intronic
901122277 1:6905549-6905571 CTTTATTATGAGAGGGAAGCGGG - Intronic
906627636 1:47338289-47338311 GGGTATTGTTAGAGGGAAGCTGG + Intronic
909228130 1:73051937-73051959 ATGTATTCTCTGAGGGATGTAGG - Intergenic
912207595 1:107525579-107525601 GTGTATACACAGATGGAAGTTGG + Intergenic
912566754 1:110592903-110592925 GAGTATGAGCACAGGGAAGTCGG - Intergenic
913667517 1:121062103-121062125 GTGTATTAACTGAGGAAACTGGG - Intergenic
914657759 1:149757453-149757475 GTGTATTAACTGAGGAAACTGGG - Intergenic
915267961 1:154732230-154732252 GTGGCTTATGAGAGGGATGTGGG - Intronic
915424594 1:155814321-155814343 GCATATTATCAGAGGTAAATCGG - Exonic
915742228 1:158127670-158127692 GTGCATTATAAGAGGGATGGTGG + Intergenic
919505083 1:198388224-198388246 GTATATTATGAAAGTGAAGTTGG - Intergenic
920174665 1:204093097-204093119 GTGTATCAGCATAGGGACGTGGG + Intronic
921388373 1:214594406-214594428 CTGAATGATGAGAGGGAAGTGGG + Intergenic
921451469 1:215312696-215312718 GGGTATTATCAGAGATAAATAGG - Intergenic
922349889 1:224726666-224726688 GTTTGTGATCAAAGGGAAGTTGG - Intronic
923509720 1:234639844-234639866 GTGTATTATGAGTGGGAAGAAGG + Intergenic
1063541715 10:6940766-6940788 GTGTATTTACAGAGGTAATTAGG - Intergenic
1065535780 10:26713594-26713616 GTTTATTCTCAAAGGGAAGTAGG + Intronic
1065924112 10:30420634-30420656 GTGTATTATCTGAGTGATCTTGG + Intergenic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1067515870 10:46942658-46942680 ATGTCTCATAAGAGGGAAGTGGG + Intronic
1067646380 10:48109152-48109174 ATGTCTCATAAGAGGGAAGTGGG - Intergenic
1068050040 10:51938634-51938656 GTGTCTTCTCAGTGGGAAGAGGG - Intronic
1072607176 10:96994550-96994572 GTGTATTTTTAGACTGAAGTGGG + Intergenic
1075331336 10:121576378-121576400 GTGTATTTTCAGAAGGTAGGAGG - Intronic
1078969454 11:16390481-16390503 CTTTATTATCAGAGAGTAGTTGG - Intronic
1079662763 11:23061488-23061510 GTGTATTATGAGATTGAACTAGG + Intergenic
1080148582 11:29020703-29020725 GTGTTTTTTCAAAAGGAAGTGGG - Intergenic
1081801952 11:45866127-45866149 GTGTATTATCTGAGGTAGGGAGG + Intronic
1084946306 11:72640658-72640680 GTGTCTTGTCAGAGAGGAGTTGG - Intronic
1087332989 11:96806421-96806443 GTGTATTATGAAAGGGAAACAGG - Intergenic
1087586223 11:100125324-100125346 GAGGATTACTAGAGGGAAGTAGG - Intronic
1087829679 11:102805869-102805891 GGGTAGGATGAGAGGGAAGTGGG - Intergenic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1090568713 11:128024299-128024321 TTGTTTTATCAAAGGGAAGAAGG + Intergenic
1091590461 12:1839733-1839755 GTCTCGTATAAGAGGGAAGTGGG - Intronic
1091937819 12:4447298-4447320 GTTTAGAATCAGAGGGAAGGCGG - Intergenic
1092842637 12:12557918-12557940 GTGTATGGAGAGAGGGAAGTGGG - Intronic
1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG + Intergenic
1100738273 12:97562381-97562403 GTGTATTTTCAAAGGGAAAATGG + Intergenic
1100997262 12:100315406-100315428 GTATATTTTCAGAGTAAAGTGGG - Intronic
1104924617 12:132307531-132307553 GTGTCTTATAAGAGAGAAGCGGG + Intronic
1104924662 12:132307868-132307890 GTGTCTTATGAGAGAGAAGTGGG + Intronic
1106030601 13:25998682-25998704 TTTTATTATTAGAGGAAAGTTGG + Intronic
1106451769 13:29888821-29888843 GTGAGTTATCAGAAGGAAGGAGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1112148375 13:96728220-96728242 GTATATGTTCAGAGGTAAGTGGG + Intronic
1114595895 14:23911338-23911360 GTGTATTATGATAGGGAACGGGG - Intergenic
1117669530 14:58092725-58092747 GGTTCTTATGAGAGGGAAGTAGG - Intronic
1126477768 15:49084033-49084055 GGTTATTTTCAGATGGAAGTGGG - Intergenic
1128810940 15:70572191-70572213 GTATCTTATAAGAGGGAAGCAGG + Intergenic
1130756298 15:86767827-86767849 TTGTATTATCAGAGAGATGGTGG - Intronic
1131024270 15:89126577-89126599 GTGTACTATCATAGTGAAGGAGG - Intronic
1133726549 16:8542746-8542768 GTGGGTTATCTGAGGGAACTGGG + Intergenic
1135335524 16:21598764-21598786 TTGAATTAGCACAGGGAAGTTGG - Intronic
1135630485 16:24032533-24032555 GTGGATTAGCAGATGGAGGTGGG + Intronic
1136250958 16:29004747-29004769 TTGTATCATCAAATGGAAGTGGG + Intergenic
1139407142 16:66728081-66728103 TTGTATTTTCAGTGGGAATTTGG - Intronic
1140720973 16:77771864-77771886 GTGTATAATCAGAGAAAAGTTGG + Intergenic
1141581120 16:84999758-84999780 CTGTATCTTGAGAGGGAAGTGGG + Intronic
1142653731 17:1375411-1375433 GTATTTTATCAGTGGGATGTGGG + Intronic
1143564196 17:7711785-7711807 GTGGCTGATCAGAAGGAAGTAGG + Intergenic
1147571435 17:41573458-41573480 GAGTATTCTTAGAGGGAAGAAGG - Intergenic
1149517199 17:57289625-57289647 GTAAATTATCAGATGAAAGTTGG + Intronic
1149664648 17:58357445-58357467 GTGAGTTTTCAGAGGGAAGTGGG - Intronic
1152059624 17:78061295-78061317 GTTTATCATCAGAGTGAATTTGG - Intronic
1153442615 18:5137405-5137427 GTGTGTTATCTGGGTGAAGTCGG + Intergenic
1156661999 18:39357312-39357334 ATGGATTATCAGATGGAGGTTGG - Intergenic
1157514801 18:48303317-48303339 GAGTCTCATCAGAGGGAGGTTGG - Intronic
1157836815 18:50911500-50911522 GAGAGTTAACAGAGGGAAGTAGG + Intronic
1159374618 18:67577125-67577147 ATGTAACATCAGAGGGATGTGGG + Intergenic
1162608484 19:11730926-11730948 GTGGAATATGAGAGTGAAGTGGG + Intronic
1163206755 19:15808935-15808957 GTGATTTATCAGAAGGGAGTAGG - Intergenic
1164444243 19:28303490-28303512 GTGCTTTATCAGAGGGATGGCGG + Intergenic
1166038763 19:40189955-40189977 TTCCATTGTCAGAGGGAAGTGGG - Intergenic
1167572958 19:50301607-50301629 GTGGAGTCTCAGAGGGAAGGTGG - Intronic
925212453 2:2061553-2061575 GTTTATTACCAGAGGGATGGAGG + Intronic
925588384 2:5485944-5485966 GAGTATTATTAATGGGAAGTTGG + Intergenic
932693098 2:73930188-73930210 GTCTGTTTTCAGAGTGAAGTAGG + Intronic
933468140 2:82682708-82682730 CTGTTTTCTCAGAGGGAAATTGG - Intergenic
934652083 2:96098575-96098597 CTGTTTTCTCTGAGGGAAGTAGG - Intergenic
936895154 2:117419309-117419331 ATATATTATCAGATGGAAGATGG - Intergenic
938451868 2:131428210-131428232 GTGTTTTAGCAGAAGGAAGTTGG + Intergenic
938797366 2:134729454-134729476 ATATTTTATCAGAGAGAAGTGGG + Intergenic
941312164 2:163947073-163947095 GTGCATTTTCAGCGGGAAATAGG + Intergenic
941547408 2:166869270-166869292 ATGTATTTTTAGAGGGGAGTGGG + Intergenic
943910277 2:193556442-193556464 ATGTATTTTCAGAAGGAGGTAGG - Intergenic
944476319 2:200110417-200110439 GAGTAGTACCAGAGGGAGGTAGG - Intergenic
947804024 2:232952194-232952216 GAGTAATATCAGTGGGAACTGGG + Intronic
948645867 2:239404054-239404076 GTGTATAATCAGTGGGAAAATGG + Intergenic
1172209976 20:33190540-33190562 GTGTATTTTCTGTGGGAGGTGGG - Intergenic
1174526627 20:51176934-51176956 GTGGAGGAACAGAGGGAAGTGGG + Intergenic
1175488164 20:59360357-59360379 GTGTATTTACAGGGGGGAGTTGG - Intergenic
1175613985 20:60376965-60376987 GTTTATCAGCAGAGGGAAGAAGG + Intergenic
1179481735 21:41682739-41682761 GCGGATTATCAGAAGGAAGCAGG + Intergenic
1179715227 21:43282882-43282904 GTGTATTCTCAGGAGGATGTGGG + Intergenic
1179947496 21:44688176-44688198 GGCTATGATCAGAGGGAAGTGGG + Intronic
1182243647 22:28937158-28937180 ATATATTATAAGAGAGAAGTAGG - Intronic
1183767795 22:39895100-39895122 GTTAAATAACAGAGGGAAGTTGG + Intergenic
951005384 3:17609813-17609835 GTATATTATCAGAGGAAACTAGG + Intronic
955410188 3:58650364-58650386 ATGTATCAACATAGGGAAGTAGG - Intronic
956393062 3:68795324-68795346 GTGTTTTATTAAAGGGAAATTGG - Intronic
958196932 3:90253759-90253781 GTGTATTTTAAAAGGGCAGTGGG - Intergenic
958468148 3:94483738-94483760 ATGTATCATCAGAGGAATGTAGG + Intergenic
958595175 3:96213306-96213328 GTGTATAATAATATGGAAGTAGG + Intergenic
959799506 3:110474845-110474867 TTGTATTATGGTAGGGAAGTGGG + Intergenic
960582972 3:119295867-119295889 GTGTTTAATCATAGGAAAGTTGG + Intronic
964593128 3:158389129-158389151 GTTAATTATAAGAGGGAAGGGGG - Intronic
965121559 3:164565179-164565201 GTGTATGATGTGAGGGTAGTGGG + Intergenic
966832390 3:184020880-184020902 GTGTTTCATCTGAAGGAAGTAGG + Intergenic
966888709 3:184390908-184390930 GTGTTTTATAAAAGGGAAATGGG - Intronic
970644226 4:18101120-18101142 GTGTATTCACAAAGGAAAGTAGG - Intergenic
974554667 4:63429379-63429401 GTGTATTTTCAGAGAGATGAGGG + Intergenic
977215025 4:94272277-94272299 ATGTATTGTCAGTGGGAAGGAGG + Intronic
977723633 4:100268879-100268901 GTGAATTATCTGAGGCAAGATGG - Intergenic
977912113 4:102549051-102549073 GTGTATTATCAGGCTGAAATGGG - Intronic
979008698 4:115338580-115338602 GGGAATGATCAGAGAGAAGTTGG - Intergenic
979534876 4:121808288-121808310 GAGTTTTATCAGAGGAAAATGGG + Intronic
981778393 4:148396844-148396866 GTATATTACCAAAGGGAACTTGG + Intronic
986957229 5:13167608-13167630 GTATGTTACCAGAGGAAAGTTGG + Intergenic
989448803 5:41562972-41562994 GAGTATTTTAAGAAGGAAGTAGG - Intergenic
989456325 5:41648382-41648404 GTGGAATCTCAGAGGGAAGGTGG + Intergenic
990343644 5:54849883-54849905 GTTTAATATCAGAGGGTGGTGGG + Intergenic
990346973 5:54880949-54880971 GGGTCTTATAAGAGGGAAATAGG - Intergenic
995090160 5:108165274-108165296 GTGTAATTACAGAAGGAAGTGGG + Intronic
997084463 5:130781645-130781667 GTATATTTATAGAGGGAAGTTGG + Intergenic
998635055 5:143944413-143944435 GTTTTTTATTAGGGGGAAGTGGG + Intergenic
998939298 5:147263150-147263172 CAGTATTATCAGAGCCAAGTGGG - Intronic
1001252189 5:170154935-170154957 GTGTCTTATCAGATGGCCGTGGG + Intergenic
1002412536 5:179094301-179094323 TTGTATGATCAGAGATAAGTTGG - Intergenic
1003790583 6:9542706-9542728 TTGTACTATAAGAGGGAAATGGG + Intergenic
1004848208 6:19669225-19669247 GAGTATTAGCAGAAGAAAGTTGG - Intergenic
1008871366 6:56276204-56276226 GTGGATTACCAGAGGGGAGAAGG + Intronic
1011829433 6:91353425-91353447 GGGTATTATTGGAGGGAAGAGGG - Intergenic
1014808608 6:125859962-125859984 TTGTTTTTTGAGAGGGAAGTAGG + Intronic
1015434319 6:133168263-133168285 GTGTATTATCAGGGGGACATGGG + Intergenic
1015532920 6:134239257-134239279 GTGTATTATCAGAGGGAAGTGGG - Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1020612126 7:10411564-10411586 GTGTAACATCAGATGGAATTTGG + Intergenic
1023222076 7:37929820-37929842 GTGTTTGATGAGAGGGCAGTGGG - Intronic
1023748611 7:43347848-43347870 GGGTTTTATAAGAGGGATGTAGG - Intronic
1030676120 7:112387591-112387613 CTGTATGATCAGACAGAAGTGGG + Intergenic
1030791295 7:113732312-113732334 CTGTGGTATCAGAGTGAAGTGGG - Intergenic
1031016263 7:116579914-116579936 GAGTATCATCAGCGGGAACTAGG + Intergenic
1035131875 7:156662103-156662125 GTGTATTAGCAGTAGGTAGTAGG + Intronic
1035312520 7:157978709-157978731 GTGCAGTCCCAGAGGGAAGTGGG - Intronic
1037680635 8:21094632-21094654 CTGTATTATGTGAGAGAAGTAGG - Intergenic
1041389509 8:57336379-57336401 GTGTTTCTTCAGAGGGAACTGGG - Intergenic
1041851366 8:62396907-62396929 GTTTATCATCAGAGGGAAAAAGG + Intronic
1042666059 8:71207769-71207791 GTTTATTATCAGAGTGATCTAGG + Intronic
1043246681 8:78012092-78012114 GGGTTTTATCAGAGGGAAGCAGG + Intergenic
1044747808 8:95388015-95388037 GTCTATTATCAGAGAGCACTTGG + Intergenic
1045218001 8:100168050-100168072 GGGTCTTATCAAAGGTAAGTGGG - Intronic
1046351034 8:113012785-113012807 CTGTATTATCAAAGGGATGTTGG - Intronic
1047091646 8:121582059-121582081 GTGTATTATCTGATGGATCTGGG + Intergenic
1047297227 8:123581682-123581704 GGGTATGATCTGAGGGGAGTTGG + Intergenic
1047911078 8:129529967-129529989 GAGAATTATCAGAGTGAAGCTGG - Intergenic
1048048702 8:130796939-130796961 GGGTGTTTGCAGAGGGAAGTTGG - Intronic
1048226296 8:132589607-132589629 GAGTATTTTCAGAGTGAGGTTGG - Intronic
1048897040 8:139001384-139001406 GCAAATTATCAGAAGGAAGTTGG + Intergenic
1051008755 9:12383420-12383442 GTGTATTCTCACATGTAAGTAGG - Intergenic
1051842639 9:21415498-21415520 GAGTATAATTAGAGGCAAGTAGG + Intronic
1052686061 9:31757641-31757663 GTGTACTATCAGAAGCAATTTGG + Intergenic
1053594419 9:39545461-39545483 GTGAACTATCAGAGGGCAGAGGG - Intergenic
1053613837 9:39743528-39743550 GTAAAATATAAGAGGGAAGTTGG + Intergenic
1053852200 9:42300494-42300516 GTGAACTATCAGAGGGCAGAGGG - Intergenic
1053866645 9:42445092-42445114 GTTCCTTAACAGAGGGAAGTTGG + Intergenic
1053871875 9:42501485-42501507 GTAAAATATAAGAGGGAAGTTGG + Intergenic
1053900885 9:42794549-42794571 GTAAAATATAAGAGGGAAGTTGG - Intergenic
1054239679 9:62598869-62598891 GTAAAATATAAGAGGGAAGTTGG - Intergenic
1054260761 9:62862994-62863016 GTAAAATATAAGAGGGAAGTTGG + Intergenic
1054553812 9:66633396-66633418 GTAAAATATAAGAGGGAAGTTGG - Intergenic
1054571838 9:66819506-66819528 GTGAACTATCAGAGGGCAGAGGG + Intergenic
1055064146 9:72101677-72101699 ATTTATTATCAGAGGGACTTGGG + Intergenic
1055551906 9:77439336-77439358 GTGTATTACAAGAGTGGAGTTGG + Intronic
1060783639 9:126432203-126432225 GGGAATTATCAGGGGGAAATGGG - Intronic
1188969135 X:36591693-36591715 GGGTCTTATCAGAGGGTAGAAGG - Intergenic
1195292182 X:103439991-103440013 GTGTATCATCACAGGGCAGAGGG - Intergenic
1195683736 X:107567532-107567554 ATGAATTAGCAGAGAGAAGTGGG + Intronic
1196348153 X:114692795-114692817 GTGTATTTTGAGATGGAAATGGG - Intronic
1198173722 X:134133747-134133769 GTGTATTATAATATGGAAATGGG - Intergenic
1199140190 X:144302100-144302122 GTCTATTAGAAGAGGGAAATTGG - Intergenic