ID: 1015539190

View in Genome Browser
Species Human (GRCh38)
Location 6:134297356-134297378
Sequence CAGCTCAGACAGCTTGGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015539185_1015539190 -4 Left 1015539185 6:134297337-134297359 CCCGCTGCAGGGCGGCCTCCAGC 0: 12
1: 16
2: 20
3: 49
4: 391
Right 1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG No data
1015539180_1015539190 11 Left 1015539180 6:134297322-134297344 CCATGTCCTGCTAGGCCCGCTGC 0: 1
1: 13
2: 9
3: 27
4: 165
Right 1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG No data
1015539183_1015539190 5 Left 1015539183 6:134297328-134297350 CCTGCTAGGCCCGCTGCAGGGCG 0: 1
1: 8
2: 13
3: 25
4: 131
Right 1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG No data
1015539186_1015539190 -5 Left 1015539186 6:134297338-134297360 CCGCTGCAGGGCGGCCTCCAGCT 0: 12
1: 14
2: 7
3: 33
4: 301
Right 1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015539190 Original CRISPR CAGCTCAGACAGCTTGGCGT TGG Intronic
No off target data available for this crispr