ID: 1015541413

View in Genome Browser
Species Human (GRCh38)
Location 6:134317796-134317818
Sequence CCAGGTAGCTGGGGGCGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 828
Summary {0: 1, 1: 0, 2: 4, 3: 82, 4: 741}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015541413_1015541430 23 Left 1015541413 6:134317796-134317818 CCTCCCCGCCCCCAGCTACCTGG 0: 1
1: 0
2: 4
3: 82
4: 741
Right 1015541430 6:134317842-134317864 GGAGCGAGTCGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 72
1015541413_1015541427 2 Left 1015541413 6:134317796-134317818 CCTCCCCGCCCCCAGCTACCTGG 0: 1
1: 0
2: 4
3: 82
4: 741
Right 1015541427 6:134317821-134317843 GCTCTTCCGCGGCCGGCGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 86
1015541413_1015541424 -5 Left 1015541413 6:134317796-134317818 CCTCCCCGCCCCCAGCTACCTGG 0: 1
1: 0
2: 4
3: 82
4: 741
Right 1015541424 6:134317814-134317836 CCTGGCTGCTCTTCCGCGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1015541413_1015541422 -9 Left 1015541413 6:134317796-134317818 CCTCCCCGCCCCCAGCTACCTGG 0: 1
1: 0
2: 4
3: 82
4: 741
Right 1015541422 6:134317810-134317832 GCTACCTGGCTGCTCTTCCGCGG 0: 1
1: 0
2: 0
3: 5
4: 108
1015541413_1015541426 1 Left 1015541413 6:134317796-134317818 CCTCCCCGCCCCCAGCTACCTGG 0: 1
1: 0
2: 4
3: 82
4: 741
Right 1015541426 6:134317820-134317842 TGCTCTTCCGCGGCCGGCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 100
1015541413_1015541425 0 Left 1015541413 6:134317796-134317818 CCTCCCCGCCCCCAGCTACCTGG 0: 1
1: 0
2: 4
3: 82
4: 741
Right 1015541425 6:134317819-134317841 CTGCTCTTCCGCGGCCGGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015541413 Original CRISPR CCAGGTAGCTGGGGGCGGGG AGG (reversed) Exonic
900146762 1:1162024-1162046 CCAGGGGTCTGGGGGTGGGGAGG - Intergenic
900182130 1:1315755-1315777 CGAGGGAGGTGGGGGCGGGGAGG + Intronic
900395205 1:2450632-2450654 ACAGGGAGCGGGGGGCAGGGGGG - Intronic
900419034 1:2547638-2547660 CCAGATTGCTGTGGGCAGGGAGG - Intergenic
900421230 1:2556845-2556867 CCAGGCAGCAGGGGACGGGCTGG - Intronic
900488086 1:2933042-2933064 CCAGGTACCTGGAGGGAGGGTGG - Intergenic
900602686 1:3509765-3509787 CCAGGCAGGTGGGGGTGGGGTGG + Intronic
900658144 1:3770303-3770325 CCAGGAGGCTGTGGCCGGGGTGG - Intronic
900951599 1:5861188-5861210 CCAGGTAGCTGGTGTAGGGCTGG - Intergenic
901012561 1:6209837-6209859 GCAGGTGGCTGGGGTCCGGGGGG + Intronic
901205534 1:7493634-7493656 CCAGGGAACTGGGGGGGGGGGGG + Intronic
901237071 1:7672886-7672908 CCAGGCAGGTGGGGGCTGGGAGG - Intronic
901241710 1:7698076-7698098 CCATGTTGGTGGGGGGGGGGGGG - Intronic
901637802 1:10678410-10678432 GCAGGTGGGTGGGGGTGGGGGGG + Intronic
901775874 1:11560185-11560207 CCAGGTCCCTGGGGGAGGTGAGG - Intergenic
901793536 1:11667275-11667297 CCAGGTAGGTGGGGGTTGGCCGG - Intronic
902214283 1:14924569-14924591 CCCGGTAGGTGCGCGCGGGGCGG + Intronic
902272284 1:15313312-15313334 CCATTGTGCTGGGGGCGGGGTGG + Intronic
902324648 1:15691799-15691821 AAAATTAGCTGGGGGCGGGGAGG + Intronic
902724083 1:18323653-18323675 GGAGGGAGCTGGGGGCAGGGCGG + Intronic
902776723 1:18679538-18679560 CCAGGAAGCTGGAGCAGGGGAGG - Intronic
902811863 1:18892543-18892565 CCAGGTAGAAGGAGGCGGGGGGG + Intronic
903322629 1:22552061-22552083 CCAGCGAGCTGGAGGCCGGGTGG + Intergenic
903328604 1:22585644-22585666 GCAGGCAGCTGGGTGGGGGGAGG + Intronic
903360155 1:22772063-22772085 CGGGGTTGCTGGGGGTGGGGTGG - Intronic
903443959 1:23408840-23408862 CCAAGTAGCTGTGGCCCGGGTGG - Intronic
903656289 1:24950593-24950615 ACAGGTGGCTGGGCGTGGGGTGG + Intronic
903748163 1:25602503-25602525 CCAGGTGTCTGGGGTGGGGGAGG - Intergenic
903788402 1:25875971-25875993 CTCGGGAGCAGGGGGCGGGGTGG - Intergenic
903907379 1:26696421-26696443 CCAGGCTGCTGGCGGCGGCGGGG - Exonic
903938816 1:26914494-26914516 CCAGGACCCTGGGGGCTGGGAGG + Intronic
904011431 1:27392598-27392620 ACCGGTGGCCGGGGGCGGGGCGG + Intergenic
904054762 1:27662808-27662830 GCAGATGGCTGGGGGAGGGGTGG - Intergenic
904271732 1:29354648-29354670 GCAGGTAGCTGGGAGCCGTGAGG - Intergenic
904586643 1:31584465-31584487 CCAGGTATCAGGTGGTGGGGCGG - Intronic
905378953 1:37546146-37546168 GCAGGGAGCGGGGGGGGGGGGGG - Intronic
905409872 1:37761378-37761400 CCAGTTGGCTGGGGGCCGTGGGG - Intronic
905720929 1:40201073-40201095 CCAGGTTGCGGGGGGGGGGGGGG - Intronic
907357268 1:53886563-53886585 ACAGGATGCTGGGGGTGGGGTGG - Intronic
908561459 1:65310191-65310213 TACGGCAGCTGGGGGCGGGGAGG + Intronic
909269723 1:73607236-73607258 CCGAGTAGCTGGGGCCGAGGCGG - Intergenic
909393065 1:75136969-75136991 TCAAGAAGCTGGGGGTGGGGTGG + Intronic
910232008 1:84997183-84997205 CCCGGTAGGAGGCGGCGGGGCGG - Intergenic
912369722 1:109164710-109164732 CCAGTGGGCTGGGGGTGGGGTGG - Intronic
913049682 1:115106252-115106274 GCAGGTGGCTGGGGGCAGGTGGG + Intergenic
914001660 1:143699709-143699731 CCGGGTGGCATGGGGCGGGGTGG - Intergenic
914673449 1:149889447-149889469 CCGGGTGGGTGGGGGCGGGGTGG - Intronic
914753801 1:150552144-150552166 CCAGAGAGCTTGGGGCTGGGAGG - Intronic
915168925 1:153964140-153964162 CCAGGTGGGTGGGGACGTGGTGG + Intronic
915309596 1:155000641-155000663 GCAGGGGGCGGGGGGCGGGGGGG - Intergenic
915351417 1:155228941-155228963 CTAGGTAGCTGGGGAGGTGGTGG + Intergenic
915354201 1:155246121-155246143 CTAGGTAGCTGGGGAGGTGGTGG + Intergenic
915564369 1:156705661-156705683 CCAGGTGGGGGGGGGCGGAGCGG - Intronic
915621300 1:157086562-157086584 GCAGGTGGATGGGGGTGGGGAGG - Intergenic
915624028 1:157103685-157103707 CCTGGAAGATAGGGGCGGGGTGG - Intergenic
915914420 1:159932423-159932445 CCAGGCTGATGGGGGTGGGGTGG - Intronic
916120520 1:161524769-161524791 CCACGTAGCTGGGCGTGGTGCGG - Exonic
916130284 1:161606401-161606423 CCACGTAGCTGGGCGTGGTGCGG - Intronic
917534087 1:175862203-175862225 CCAAGGAGCTGGGGGGAGGGAGG - Intergenic
917730564 1:177870816-177870838 GCAGTTAGTTGGGGGTGGGGAGG + Intergenic
917854558 1:179090091-179090113 CCATGTGGTTGTGGGCGGGGTGG + Intronic
919653057 1:200169373-200169395 CCAGGGGGCTGGGGGCTGTGAGG - Intronic
919810375 1:201405519-201405541 CTGGGCAGCCGGGGGCGGGGGGG - Exonic
919978836 1:202629855-202629877 GCAGGCAGCTGGTGGGGGGGGGG + Intronic
920066715 1:203274283-203274305 GTAGGTGGCTGGGGGTGGGGTGG + Intergenic
920187817 1:204172575-204172597 GCAGGGAGCTGGGGGAGGAGGGG + Intergenic
920338550 1:205260685-205260707 CCAGGGGGCTGGGGTGGGGGTGG - Intronic
921048030 1:211491174-211491196 CCAGGCAGATGGGTGCAGGGTGG - Intronic
922416659 1:225428227-225428249 CCAGGCAGGGTGGGGCGGGGCGG - Intronic
922615246 1:226957282-226957304 CCAGGGAGGTGGGGGGGGGGGGG - Intronic
922864554 1:228848502-228848524 CCAGTTGGCTGGGGGGGGGGGGG - Intergenic
923018712 1:230146709-230146731 CCAGGTTGCAGGGGGAGGGGTGG + Intronic
923460613 1:234206450-234206472 CCTGGTTCCTGGGGGTGGGGGGG + Intronic
1062838704 10:652898-652920 CGAGGTAGCTGTGGGCGGGGAGG - Intronic
1063525212 10:6778687-6778709 GAAGGTAGGTGGGGGGGGGGAGG + Intergenic
1064581755 10:16799825-16799847 TTTGGTAGCCGGGGGCGGGGAGG + Intronic
1065290403 10:24223847-24223869 CCAGTTATCTGGGGGTGGGCGGG - Intronic
1065470947 10:26081138-26081160 CCTGGTAGCGGGGGCGGGGGGGG - Intronic
1065932770 10:30494068-30494090 CCAGGGAGCAGGGAGCGGAGGGG + Intergenic
1065970087 10:30799286-30799308 CCAGGTGGCGGGGGGGGGGTGGG - Intergenic
1066747564 10:38616191-38616213 CCAGGAGGCGGGGGGTGGGGGGG + Intergenic
1067453663 10:46397978-46398000 CCAGTTAGCTGGGCACAGGGAGG - Intergenic
1067681941 10:48447005-48447027 GCAGGGAGCTGTGGGAGGGGAGG - Intronic
1067815931 10:49476887-49476909 CCAGGTAGGTGGCAGAGGGGTGG - Intronic
1068549003 10:58385367-58385389 GTCGGTAGATGGGGGCGGGGCGG - Exonic
1069043323 10:63717582-63717604 CCAGCTACTTGGGGGCGGGGGGG - Intergenic
1069683456 10:70301246-70301268 CCTGGGGGCTGGGGGCGGGTGGG - Exonic
1069760720 10:70809321-70809343 CAGGGTAGCCGGGGGCGGGGGGG - Intergenic
1069884511 10:71615433-71615455 GCATGGAGCTGGGGGCAGGGGGG - Intronic
1070064245 10:73018131-73018153 TCAGGGAGTTGGGGGAGGGGTGG - Intronic
1070140174 10:73732903-73732925 GCAGGTGTCTGGGGGCGTGGGGG - Intergenic
1070325284 10:75384830-75384852 CCAGGGGGCTGGGGACAGGGAGG - Intergenic
1070788038 10:79173505-79173527 GCGGGGAGCAGGGGGCGGGGTGG + Intronic
1070954228 10:80454116-80454138 CGAGGCGGCTGGGGGAGGGGCGG + Intergenic
1071566579 10:86674367-86674389 GCTGGGGGCTGGGGGCGGGGAGG - Intronic
1071798355 10:89029949-89029971 CGAGGTTGGTGGGGGCTGGGAGG + Intergenic
1071985641 10:91047363-91047385 CCAGGTTGGTGGGGGGCGGGTGG + Intergenic
1072276525 10:93828715-93828737 CCAGGTGGCATGGGGCTGGGAGG - Intergenic
1072742272 10:97916546-97916568 CCAGGTGTCTGGAGGCAGGGTGG + Intronic
1074237860 10:111604098-111604120 CCTGAAAGCTGGGGGCGGGCAGG - Intergenic
1075095521 10:119468513-119468535 CTTGGGAGCTGGGGGTGGGGGGG - Intergenic
1075522291 10:123150137-123150159 GCGGGCAGCTGGGGGCGGCGCGG - Exonic
1075573069 10:123559217-123559239 CCTGGTAGATGGGATCGGGGCGG + Intergenic
1075684243 10:124353083-124353105 CCATGTAGCTGGGGGTTTGGGGG - Intergenic
1075703482 10:124484255-124484277 GCAGGCAGCTGGTGCCGGGGCGG - Exonic
1076260404 10:129060380-129060402 ACAGGAAGGTGGGCGCGGGGTGG + Intergenic
1076463236 10:130660533-130660555 CCAGGCAGCTGGGGGTGATGTGG - Intergenic
1076659774 10:132047874-132047896 TCAGCTCGCGGGGGGCGGGGCGG - Intergenic
1076778360 10:132710453-132710475 ACAGGTAGGTGTGGGCGGGCAGG + Exonic
1076916276 10:133424338-133424360 GCAGCTGGCTGGGGGCGGGACGG + Intronic
1076936383 10:133569133-133569155 GCAGCTGGCTGGGGGCGGGACGG + Intronic
1077079978 11:720928-720950 CGGGGTCGCAGGGGGCGGGGAGG + Intronic
1077250729 11:1559536-1559558 CCAGCCAGCTGGAGGCAGGGAGG - Intronic
1077340573 11:2024649-2024671 CCAGGTAGGTGCCGGTGGGGGGG - Intergenic
1077380746 11:2236125-2236147 CCGTGCTGCTGGGGGCGGGGAGG - Intergenic
1077401421 11:2359861-2359883 CCCGGTGCCTGGGGGCGGGTGGG + Intergenic
1077427314 11:2489190-2489212 CCACATAGCTGGGGGATGGGAGG - Intronic
1078153505 11:8778655-8778677 CCACGTACCCGGGGGCTGGGAGG + Intronic
1078191287 11:9094059-9094081 AGAGGCTGCTGGGGGCGGGGGGG - Intronic
1078417070 11:11174635-11174657 CCAGTTAGCTGGGGGGTGGGAGG - Intergenic
1078642519 11:13109603-13109625 CCAGGTGCCTGGGGCAGGGGTGG - Intergenic
1079098908 11:17528614-17528636 CTAGGTAGGTAGGGGCTGGGTGG + Intronic
1079527944 11:21413338-21413360 CAAGGGTGCTGGGGGTGGGGGGG + Intronic
1079555140 11:21751369-21751391 CCCCAGAGCTGGGGGCGGGGGGG - Intergenic
1080383860 11:31799071-31799093 TCAGATTGCTGGGGGCGGAGGGG + Intronic
1080387340 11:31817808-31817830 CCTGGGAGCGGAGGGCGGGGAGG + Exonic
1080411513 11:32029263-32029285 ACAGGAAGCTGGGGGCTGGGAGG + Intronic
1081121297 11:39269793-39269815 CCAAGTAGCTGGGGTCGCGGGGG - Intergenic
1081588301 11:44402844-44402866 CCAAGTAGATGGGGGTGGGGAGG - Intergenic
1081636881 11:44727325-44727347 CCAGGTCCCCGGGGGCGCGGCGG - Intronic
1081968357 11:47182985-47183007 CCAGGTATGTGGGGGGGCGGGGG - Exonic
1082090563 11:48085955-48085977 CCAGGGGTCTGGGGGTGGGGTGG + Intronic
1082786778 11:57321746-57321768 CCAGGTGGCTGGGAGGGGGGTGG - Intronic
1083226938 11:61291245-61291267 CCAGGTAACTGGGGATGGGAAGG - Exonic
1083572740 11:63768877-63768899 CCAGCTCGCGGGGGGCTGGGGGG + Intergenic
1083625500 11:64069990-64070012 CCAGGAAGCTGGGGGACAGGCGG + Intronic
1083712766 11:64559254-64559276 TGAGGGAGCTGGGGGCTGGGAGG - Intronic
1083756907 11:64796790-64796812 CGGGGTAGGTGGGGGCAGGGAGG - Exonic
1083764484 11:64835472-64835494 CCAGGCAGCTGGTGGCAGGGAGG - Intronic
1084083999 11:66846438-66846460 CCAGGAAGTTGGGGGGTGGGGGG - Exonic
1084165569 11:67373397-67373419 CCAGGGAGCTGGGCTCGGGCCGG - Intronic
1084313450 11:68330227-68330249 ACAAGGGGCTGGGGGCGGGGTGG - Intronic
1084364735 11:68690231-68690253 ACAGGGAGCTGGTGGTGGGGAGG + Intronic
1084563279 11:69915819-69915841 CCAGTGAGGTGGGGGTGGGGAGG + Intergenic
1084600997 11:70145516-70145538 CCTGGCGGCTGGGGGTGGGGTGG - Intronic
1084707702 11:70824959-70824981 CCAGGAAGCTGGGGGCTCTGCGG - Intronic
1085472035 11:76764621-76764643 CCAGGTGGGTGGGGGCAGGAAGG - Intergenic
1086497069 11:87415273-87415295 ACAGGTGGCAGGGGGTGGGGAGG + Intergenic
1087087208 11:94231914-94231936 CCAGGTACCAGGGGTCGGGATGG + Intergenic
1087130879 11:94668509-94668531 CCAGGGGGCTGGGGGCCGGGGGG - Intergenic
1088650012 11:111949219-111949241 CCCAAGAGCTGGGGGCGGGGTGG - Intronic
1088675438 11:112188057-112188079 CCCAAGAGCTGGGGGCGGGGTGG - Intronic
1088892871 11:114058803-114058825 CCAGATTGCTGGGGGGCGGGGGG + Intergenic
1089055567 11:115582197-115582219 CCCAGTAGATGGGGACGGGGTGG + Intergenic
1089258039 11:117204383-117204405 CCAAGGAGCTGGGGGAGGGCCGG - Exonic
1089400940 11:118164346-118164368 CCAGCCAGCTGGGGGCAGAGAGG - Exonic
1089458746 11:118640718-118640740 CCAGGTTGTTGGGGACGGGGAGG + Intronic
1089824211 11:121258978-121259000 GCAGGGAGGTGGGGGGGGGGCGG - Intergenic
1089848728 11:121479207-121479229 CCAGGGAGGTGGAGGCGGGAGGG + Intronic
1090193331 11:124792870-124792892 TCAGGTATCTGGAGGGGGGGAGG - Intronic
1090457207 11:126860545-126860567 CCAGGCAGCAGGCGGCGTGGAGG + Intronic
1090634505 11:128682340-128682362 AGAGGCAGCTGGGGGCAGGGAGG - Intergenic
1090818143 11:130315930-130315952 CCAGGTGCCTGGGGGCGGGCGGG + Intergenic
1090854297 11:130598451-130598473 CCAGGAAGATGGGTGCTGGGTGG + Intergenic
1091259925 11:134225547-134225569 CCAGGGAGATGGGGACGGCGAGG + Intronic
1202823558 11_KI270721v1_random:79838-79860 CCAGGTAGGTGCCGGTGGGGGGG - Intergenic
1091479366 12:810875-810897 CCAGGCTGCTGGGGGTGGGGTGG - Intronic
1091587817 12:1826403-1826425 CCAGTTGGCGGGGGGGGGGGGGG - Intronic
1091706310 12:2695652-2695674 ACAGGGAGCTGGGGCTGGGGAGG - Intronic
1091711538 12:2743881-2743903 ACAGGGAGCTGGGGCTGGGGAGG - Intergenic
1091919610 12:4293869-4293891 GCTGGAAGCTGGGGGTGGGGAGG + Intronic
1092233838 12:6793213-6793235 ACAGGGAGCTGGAGGCAGGGAGG + Intronic
1092378182 12:7973056-7973078 CCAAGGAGCGGGGGGCGGGGGGG - Intergenic
1092885737 12:12923108-12923130 CCAGGGCCTTGGGGGCGGGGAGG - Intergenic
1092946363 12:13457815-13457837 CCAGTTGGCTGGTGGTGGGGAGG + Intergenic
1095957062 12:47813091-47813113 GCGGGGAGCTGGAGGCGGGGCGG - Intronic
1096113061 12:49040343-49040365 TCAGGGGGCTGGGGTCGGGGTGG + Exonic
1096466296 12:51848950-51848972 CAGGGGAGGTGGGGGCGGGGCGG - Intergenic
1096529522 12:52234146-52234168 CCAGGCAGGTGGGGGAGGGGAGG - Intronic
1096675719 12:53224766-53224788 GCAGGTAGCTGGGGAGGGTGCGG - Intronic
1096818100 12:54214520-54214542 CCAGGCAGCTGGGAGCAGGCAGG + Intergenic
1096823912 12:54259595-54259617 CCAGGCAGCTGGGTGGGGGCAGG - Intronic
1096870217 12:54588259-54588281 TCAGTTTGCGGGGGGCGGGGGGG - Intronic
1097089937 12:56496987-56497009 CCGGGAAGCGGGGGGGGGGGAGG + Intergenic
1097190488 12:57217110-57217132 GCTCGGAGCTGGGGGCGGGGCGG - Intronic
1097261094 12:57720699-57720721 CCAGGCAGCTGGGGGAAGGCAGG - Intronic
1097713336 12:62938411-62938433 ACAGGGGGCTGGGGGAGGGGAGG + Intergenic
1097953559 12:65460208-65460230 CCAGTTGGCTGGGGCCTGGGAGG + Intronic
1098990692 12:77062083-77062105 CCTGGTAACTGAGGGCAGGGTGG + Intronic
1098991220 12:77066036-77066058 ACAGGTTGCTGAGGGCGGGCGGG - Intergenic
1100891586 12:99132001-99132023 GTAGGCAGCTGGGGGAGGGGAGG - Intronic
1101764361 12:107684350-107684372 TCAAGTTGGTGGGGGCGGGGGGG + Intergenic
1102229906 12:111255473-111255495 GCAGGTAGGTGGGGGACGGGAGG - Intronic
1102771502 12:115481241-115481263 TCAGGGAGCTGGGGGCTGGGAGG - Intergenic
1103562510 12:121800065-121800087 CCGGGCCGCTGGGGGAGGGGCGG - Intronic
1103906097 12:124327895-124327917 CCAGGGAGGTGGGGTAGGGGAGG + Intronic
1104440851 12:128792108-128792130 CCAGGAAGTTGGGGGGGTGGGGG - Intergenic
1105019968 12:132809437-132809459 CCGGGAACCGGGGGGCGGGGGGG - Intronic
1105202839 13:18194560-18194582 CCGGGGATCTGGGGGCGAGGTGG - Intergenic
1105251427 13:18701987-18702009 CCAGGGGGCTGGGGGCAGCGAGG + Intergenic
1105512345 13:21061315-21061337 GCTGGGAGCTGGGGTCGGGGCGG - Intronic
1105864955 13:24451194-24451216 CCTGGGAGCAGGGGGCAGGGAGG + Intronic
1106335372 13:28778422-28778444 CCAGGGAGCTGGGGCCTCGGGGG + Intergenic
1106360304 13:29025319-29025341 TCAGATACCTGGGGGTGGGGAGG + Exonic
1106498814 13:30307557-30307579 CCAGGTTGCCGGGGGGAGGGAGG + Intergenic
1106721316 13:32437575-32437597 CCAGGTAGCTGGAGGAGGACTGG - Intronic
1107998879 13:45888551-45888573 CCAGGAGCCTGGGGGAGGGGAGG + Intergenic
1110450573 13:75635429-75635451 CCGGGGGGTTGGGGGCGGGGCGG - Intronic
1110711605 13:78656720-78656742 CATGGTACCTGGGGGGGGGGGGG + Intronic
1111997152 13:95176208-95176230 CCAGGAAGCCGAGGGCAGGGGGG + Intronic
1112248308 13:97754523-97754545 CCAGGTGGCGGGGAGTGGGGCGG - Intergenic
1112508468 13:99989382-99989404 CCACGAAGTTCGGGGCGGGGAGG + Intergenic
1113520417 13:110936646-110936668 CCAGGTGAGTGTGGGCGGGGCGG + Intergenic
1113737889 13:112690723-112690745 CCAGGGCGCTGCGGGCGGGAAGG - Intronic
1113778838 13:112964093-112964115 CAGGGTTGCAGGGGGCGGGGGGG + Intronic
1113852405 13:113425237-113425259 GCAGGGAGTTGGGGGTGGGGAGG + Intronic
1113924127 13:113930831-113930853 CCAGGGAGCTGAGGCCCGGGTGG + Intergenic
1114473737 14:22980757-22980779 CCAGGTGCCCGCGGGCGGGGCGG - Intronic
1114477848 14:23010264-23010286 CCCCGGAGTTGGGGGCGGGGGGG + Intergenic
1114551312 14:23534267-23534289 CCAGGTGGCTGTGGGTGGAGAGG + Exonic
1114604917 14:23988759-23988781 GAAGGTAGCTGGCTGCGGGGCGG + Intronic
1114610389 14:24036381-24036403 CCAGCTGGCTGAGGGCGGGGAGG + Intergenic
1114663805 14:24367226-24367248 CCAGCCTGTTGGGGGCGGGGGGG + Intronic
1116876114 14:50113779-50113801 CCACTTACTTGGGGGCGGGGGGG + Intronic
1116944269 14:50821802-50821824 CCGGGGTGCTGGGGGTGGGGCGG - Intronic
1116958061 14:50944142-50944164 CAAGGTAACCGGGGGCGGGACGG - Exonic
1117250164 14:53928725-53928747 CCAGCTACCTGGGGGCGCTGAGG + Intergenic
1117803980 14:59470940-59470962 GGGGGTGGCTGGGGGCGGGGGGG + Intronic
1117980802 14:61340363-61340385 CCAGGTGGGAGGGGGCGGGGTGG + Intronic
1118119121 14:62818094-62818116 ACCAGGAGCTGGGGGCGGGGGGG + Intronic
1119670808 14:76516874-76516896 CCAAGTGGCTGGGGGGAGGGTGG - Intergenic
1119970798 14:78968053-78968075 TAAGATAGCTGGGGGGGGGGGGG - Intronic
1120685695 14:87534068-87534090 CCATGGACCTGGGGGTGGGGTGG - Intergenic
1120862516 14:89267429-89267451 CCAGGAAGCAGGGGCTGGGGCGG + Intronic
1121330494 14:93046579-93046601 CCCAGCAGCCGGGGGCGGGGGGG + Intronic
1121635479 14:95451277-95451299 CCAGGTGCCTGGGGGCAGGCAGG - Intronic
1121805874 14:96822051-96822073 ACAGGGAGTTGGGGGCGGGAGGG - Intronic
1122414328 14:101541595-101541617 CCAGGCAGGTGAGGGCGTGGAGG + Intergenic
1122481098 14:102048025-102048047 CAAGGTAGCTGGGAGGGTGGCGG + Exonic
1122602421 14:102928347-102928369 CCAGGGGACTGGGGGCGGGGTGG + Intronic
1122621023 14:103057671-103057693 GCAGGGAGCCGGGCGCGGGGCGG - Intergenic
1122625492 14:103083523-103083545 GCAGGAAGCAGGGGGGGGGGGGG - Intergenic
1122627672 14:103092471-103092493 CCTGGGAGCTGGGGGGCGGGTGG + Intergenic
1122741728 14:103875462-103875484 ACAGGTGGGTGGGGGTGGGGTGG + Intergenic
1122785841 14:104162923-104162945 CCAGGTTTCTTGGGGCGGGGCGG - Intronic
1122861148 14:104582894-104582916 CTCGGCAGGTGGGGGCGGGGAGG - Intronic
1122885143 14:104707540-104707562 CCAGGGAGCAGGGGTGGGGGTGG - Exonic
1122885242 14:104707771-104707793 CCAGGCAGCAGGGGTGGGGGTGG - Exonic
1122885484 14:104708580-104708602 CCAAGGAGGTGGGGACGGGGAGG + Exonic
1122900584 14:104780720-104780742 CCTGGTGGGTGGCGGCGGGGCGG - Intronic
1122920464 14:104877852-104877874 ACAGGTGGCGGGGGGGGGGGGGG - Intronic
1123011379 14:105351089-105351111 CCAGGTGGCTGGAGGGCGGGCGG - Intronic
1124155918 15:27225332-27225354 CCACGTGGAGGGGGGCGGGGAGG - Intronic
1124239342 15:28017055-28017077 CTGGGGAGCGGGGGGCGGGGGGG + Intronic
1124410500 15:29432752-29432774 GCAGGGAGCTGGGGGAGGAGGGG - Intronic
1124581858 15:30962903-30962925 CCAGGTAGCTGGTGAGGAGGAGG + Intronic
1124684630 15:31771665-31771687 CCAGGAGGCTGGGGTCAGGGTGG - Intronic
1124888129 15:33706392-33706414 CCAGGGACTTGGGGGAGGGGAGG - Intronic
1124971967 15:34496551-34496573 CCAGGGTGGTGGTGGCGGGGGGG + Intergenic
1125553589 15:40566129-40566151 CCTGGAAGCTGGGGATGGGGAGG - Intergenic
1128555929 15:68631686-68631708 CCAGGTGCCAGGGGGCAGGGTGG + Intronic
1128806930 15:70538146-70538168 CCAGGGAGCAGGAGGTGGGGAGG - Intergenic
1128987235 15:72230531-72230553 CCAGCAAGCAGGGGGAGGGGCGG + Intronic
1129208006 15:74048589-74048611 CCGGGTGGCGGGGGGGGGGGGGG - Intergenic
1129208014 15:74048596-74048618 CCAGGCACCGGGTGGCGGGGGGG - Intergenic
1129235897 15:74223579-74223601 ACTGGTGGCTGGGGGAGGGGTGG - Intergenic
1129674233 15:77623662-77623684 GGAGGCAGGTGGGGGCGGGGCGG - Intronic
1130910363 15:88266406-88266428 GCAGGTGGCGGGGGGCGGGTGGG + Intergenic
1131035942 15:89222026-89222048 CCTGCTGGCTGGGGGAGGGGTGG - Intergenic
1131187489 15:90287307-90287329 CCCGGTGTCGGGGGGCGGGGAGG + Intronic
1131441875 15:92465671-92465693 GCGGGTACCTGGGGGTGGGGTGG - Exonic
1131514221 15:93066532-93066554 CCAGAAAGCAGGTGGCGGGGAGG - Intronic
1131537210 15:93247501-93247523 CCATGAAGCTGAGGGCGGTGGGG + Intergenic
1131666823 15:94579653-94579675 CAAGGTTGATGGGGGGGGGGGGG + Intergenic
1131837992 15:96409431-96409453 CCGGGGAGCTGGGGACGGGGTGG + Intergenic
1132255714 15:100373937-100373959 CCAGTGGGGTGGGGGCGGGGTGG + Intergenic
1132310460 15:100853911-100853933 GCAGGGAGCTGGGGGCAGGGAGG - Intergenic
1132312837 15:100869736-100869758 CCTGGTGGCTGGTGTCGGGGTGG + Intergenic
1132396928 15:101481198-101481220 CCAGGTGGCAGGGGGCCTGGGGG + Intronic
1132490654 16:228913-228935 CCAGGTCGCTGGCAGCCGGGTGG - Intronic
1132674745 16:1117018-1117040 AAAGGAAGGTGGGGGCGGGGAGG - Intergenic
1132748027 16:1445096-1445118 CCAGGTGGAGGGGGGCGGGCCGG - Exonic
1132843465 16:1989761-1989783 CCAGGTCCCCGGGGGCAGGGTGG - Intronic
1132983109 16:2749324-2749346 CCAGGCAGCTGGGAGGTGGGAGG + Intergenic
1133014704 16:2933976-2933998 CCAGGTACCTGGGGGTGGGCTGG + Exonic
1133197862 16:4183875-4183897 CGTGGGCGCTGGGGGCGGGGCGG - Intergenic
1133290183 16:4715358-4715380 CCAGGCAGCTGGGGGAGGCAGGG + Intronic
1133342197 16:5044164-5044186 CAGGGTAGGTGGGGGCCGGGAGG - Exonic
1133770954 16:8867081-8867103 CCAGGTGGGTGGTGGCGGTGGGG - Intronic
1133796264 16:9049005-9049027 AGAGATGGCTGGGGGCGGGGGGG - Intergenic
1133853676 16:9529343-9529365 CCAGCAAGCTGGGGGCCTGGGGG + Intergenic
1133950511 16:10387827-10387849 CCGGGTGGCGGGGGGAGGGGGGG - Intronic
1135479922 16:22814073-22814095 CCAGGTCCCTGGGCGCGGCGCGG + Intergenic
1135714067 16:24745796-24745818 ACAATTAGCTGGGGGGGGGGGGG - Intronic
1136254546 16:29029404-29029426 CCCGGCAGCCGGGGGAGGGGTGG + Intergenic
1136398765 16:30006670-30006692 TCAGGTACCTGGGGGTGGGGTGG + Exonic
1139409920 16:66751224-66751246 CCAGGTCGCTGGGGTGGGCGAGG - Intronic
1139544971 16:67645803-67645825 CAAGGTAGCTGCTGGCGGGCGGG - Intronic
1139548214 16:67659701-67659723 CCAGGTCGCTGAGGGCGGCGCGG - Exonic
1139582924 16:67883941-67883963 CCAGGTAGCTGGGGATGGGGGGG - Exonic
1139665104 16:68449415-68449437 CGAGTTAGCTGAGGGCAGGGTGG - Intergenic
1139691874 16:68646357-68646379 CCCAGACGCTGGGGGCGGGGTGG - Intronic
1139896237 16:70289760-70289782 TCCGGGAGCCGGGGGCGGGGGGG - Intronic
1140762653 16:78124878-78124900 ACAGAGAGATGGGGGCGGGGAGG + Intronic
1141007711 16:80368420-80368442 GCAAGTAGGTGGGGGCGCGGTGG - Intergenic
1141159016 16:81616936-81616958 CCAGGCAGCTGGGGCCCAGGAGG + Intronic
1141303863 16:82842641-82842663 CCAGGGACATGGGGGAGGGGAGG + Intronic
1141490718 16:84370803-84370825 CAAAGTGGCTGGGGGAGGGGAGG - Intronic
1141611210 16:85182158-85182180 CCTGGCAGCGGGGGGCGGGGAGG - Intronic
1141638711 16:85329107-85329129 CCAGGGAGCTGTGGGGGAGGGGG - Intergenic
1141671765 16:85495852-85495874 CCAGGAGGCTGGAGGTGGGGAGG + Intergenic
1141722721 16:85765839-85765861 CCAGGGACCTGGGGCAGGGGAGG + Intergenic
1141830957 16:86509893-86509915 CCAGGTTGGTGGAGGCGGGGCGG + Intergenic
1142193066 16:88726680-88726702 CCAGGGCGGTGGGTGCGGGGGGG + Intronic
1142213388 16:88819184-88819206 GCAGGTGGCCGGGGGTGGGGAGG - Intronic
1142262467 16:89049411-89049433 CCATGCAGCTAGGGGCGAGGTGG + Intergenic
1142273930 16:89105796-89105818 CCAGGGAGCTGAGGGCAGGTTGG + Intronic
1142305213 16:89280748-89280770 CCAGGTAGCTGGGCTCCGGGGGG + Exonic
1142374900 16:89701727-89701749 CCGTGACGCTGGGGGCGGGGCGG + Intergenic
1142605285 17:1078037-1078059 GCAGCTGGCTGGGGGCTGGGGGG - Intronic
1142675685 17:1511856-1511878 GCAGGGAAGTGGGGGCGGGGAGG + Intronic
1143371637 17:6444239-6444261 CCACGAGGCTGGCGGCGGGGCGG + Intergenic
1143460489 17:7100683-7100705 CCACGGAGCGGGGGTCGGGGAGG + Intergenic
1143473460 17:7190484-7190506 CCAGGAACCTGGGGTCTGGGGGG - Exonic
1143478419 17:7215893-7215915 GCAGGCAGCTGGGGGCTGGGGGG - Intronic
1143984071 17:10895950-10895972 CCAGGGTGCTGGGGGTAGGGAGG + Intergenic
1144113609 17:12063969-12063991 TCAGGGGGCGGGGGGCGGGGAGG + Intronic
1144670292 17:17129001-17129023 CCAGGCAGCTGGGAGCTGGGTGG + Intronic
1144696197 17:17305401-17305423 CCACGTGTGTGGGGGCGGGGGGG - Intronic
1144703243 17:17351915-17351937 CAAGGTGGCGGGGGGCGGGGTGG - Intergenic
1144756444 17:17682709-17682731 CCAGGAAGCTGGGGCCGCGACGG - Intronic
1144872132 17:18378009-18378031 CCAGGGAGCTAGGGTGGGGGTGG + Intronic
1145006251 17:19340036-19340058 CCGGGAAGCCGGGGGGGGGGGGG - Intronic
1145910146 17:28537574-28537596 GCTGGTAGCTGGGGGCGCAGAGG + Exonic
1146031834 17:29372950-29372972 AAAGTTAGCTGGGGGCGCGGTGG - Intergenic
1146062009 17:29612637-29612659 GCAGGAGGCTGGGGGCGCGGGGG - Exonic
1146256062 17:31392062-31392084 CGGGGGAGCTGGGGGAGGGGCGG - Intronic
1146456358 17:33012640-33012662 TCAGTTTGCTGGGGGTGGGGAGG + Intergenic
1146458148 17:33023107-33023129 CCAGTTAGGTGGAGGCTGGGAGG + Intronic
1146773198 17:35587660-35587682 GCAGGTAGTTGGGGGCAGGAGGG + Intronic
1146925103 17:36739105-36739127 ACAGGGAGCTGGGGGTAGGGAGG + Intergenic
1146935383 17:36809717-36809739 CCTGGTAGGTGGGGGAGGGCAGG + Intergenic
1147215479 17:38896579-38896601 CCAGGAAGCAGGGGACGGAGTGG + Intronic
1147318572 17:39632727-39632749 GCTGGGAGCTGGGGGCTGGGTGG + Intronic
1147602523 17:41755130-41755152 CCAGGCAGCTGGAGACAGGGAGG + Exonic
1147647243 17:42041021-42041043 CCAGGAAGGTGGTGGCGGGCTGG + Intronic
1147662652 17:42125241-42125263 GCAGGGAGGTGGGAGCGGGGAGG + Intronic
1147793037 17:43025174-43025196 CCGCCTGGCTGGGGGCGGGGCGG + Intergenic
1148684170 17:49491451-49491473 CCAGGAAGCTTGGGGGTGGGGGG + Intergenic
1148687341 17:49508243-49508265 CCAGCCAGCTGGGGGCGGGGCGG + Intronic
1148863707 17:50617926-50617948 CCAGGTAGCCGGGAGGTGGGGGG + Exonic
1149313999 17:55421873-55421895 CCGGGCGGCTGGGGGCGGGAGGG + Exonic
1149991515 17:61386212-61386234 CCAGGTAGCAGGTGGCCAGGGGG + Intronic
1150002669 17:61451671-61451693 CCCGGTGGCCGGGTGCGGGGCGG - Intergenic
1150035233 17:61788977-61788999 CCAGGTACTTGGGGGCGCTGAGG + Intronic
1150217336 17:63477842-63477864 CCACGGTGCTGGGGGAGGGGAGG - Intergenic
1150303805 17:64067453-64067475 CCAGGTAGGTGGGGGAGTGGCGG + Intronic
1150790600 17:68198172-68198194 CCGGAGAGCAGGGGGCGGGGCGG + Intergenic
1151596117 17:75078840-75078862 GAAGGTTGGTGGGGGCGGGGGGG + Intergenic
1151693681 17:75703123-75703145 CCTGTTAGCTAGGGGCCGGGAGG - Intronic
1151765645 17:76132044-76132066 CCTGGGGGCTGTGGGCGGGGTGG + Intergenic
1151954391 17:77373270-77373292 CCCGGGAGGCGGGGGCGGGGCGG + Intronic
1151956851 17:77384417-77384439 CCGGGGAGGTGGGGGCAGGGTGG + Intronic
1152207273 17:78980848-78980870 CCAGGCTGCTGGGGCCGGTGGGG + Intergenic
1152388927 17:79991688-79991710 ACAGGCAGGTGGGGGTGGGGCGG + Intronic
1152468211 17:80477228-80477250 CCCGGGAGCTGGGGGAGGGGAGG - Intronic
1152701746 17:81822994-81823016 CCAGGTGGCTGGGGGAGGGCAGG + Intronic
1152779237 17:82219095-82219117 CCAGGCAGGTGTGGGCAGGGAGG + Intergenic
1152799739 17:82325312-82325334 GGAGGGAGCTGGGGGCGGTGGGG - Intronic
1153005543 18:495843-495865 CCAGCTAGTTGGTGGCGGGGGGG - Intronic
1155253882 18:23977924-23977946 TCAGGAGGCTGGGGGCTGGGTGG - Intergenic
1156325533 18:36071506-36071528 CCAAGGGGCTGGGGGCGGGGGGG + Intergenic
1157194054 18:45606054-45606076 CCATCCAGCTGGAGGCGGGGAGG + Intronic
1157673153 18:49547830-49547852 ACAATTAGCTGGGGGTGGGGTGG + Intergenic
1160578419 18:79870026-79870048 CCAGGTGGCTGGGGGCCCAGAGG - Intronic
1160696868 19:489121-489143 GCCGGGAGCTGTGGGCGGGGTGG + Intergenic
1160808885 19:1004506-1004528 CCAGGAACCTAGGGGCAGGGCGG - Exonic
1160826280 19:1082008-1082030 CCAGGCAGGAGGAGGCGGGGTGG + Intronic
1160864835 19:1251990-1252012 CCAGGAGGCTGGGGGAGGGGAGG + Intronic
1160990826 19:1859702-1859724 CGTGGTGGCGGGGGGCGGGGTGG - Intronic
1161079465 19:2303345-2303367 GCAGGGAGCTGTGGGGGGGGGGG + Intronic
1161082794 19:2319802-2319824 CTAGGTGGCCGGGGCCGGGGAGG + Intronic
1161293438 19:3507534-3507556 CCCGGTAGACTGGGGCGGGGCGG - Intronic
1161393305 19:4032290-4032312 CCAGGCAGCTGAGGGCCAGGTGG + Intronic
1161595203 19:5147772-5147794 CCAGAGTGCTCGGGGCGGGGGGG + Intronic
1161660709 19:5544205-5544227 CCAGGGAACTGGGGGCCTGGCGG - Intergenic
1161851189 19:6738952-6738974 CCAGATGTCTGGGGGAGGGGCGG + Intronic
1161906934 19:7163645-7163667 CGAGGGAGCTGGGGATGGGGAGG + Intronic
1162575555 19:11496923-11496945 CCAAGTGGGTGAGGGCGGGGAGG - Intronic
1162706056 19:12555590-12555612 CCAGGTGGCTGCGGGAGCGGCGG + Intronic
1162774335 19:12969866-12969888 CCAGGCAGCTGGGGATGGGCAGG + Exonic
1162953570 19:14085866-14085888 CCAGGAACCTGGCGGTGGGGAGG + Intronic
1163446790 19:17351684-17351706 CCAGGAGGCTGGAGGAGGGGAGG + Exonic
1163530870 19:17848081-17848103 TGCGGGAGCTGGGGGCGGGGAGG + Intergenic
1163593156 19:18205364-18205386 CCAGGGCACTGGGGGCGGGCTGG - Intergenic
1163633811 19:18429455-18429477 GCGGGTCGCAGGGGGCGGGGGGG + Intronic
1163719788 19:18893694-18893716 CCAGGTGGCTGTGGGCATGGGGG - Intronic
1163906656 19:20154487-20154509 CCAGCTACCTGGGGGGGTGGGGG + Intergenic
1163949727 19:20572332-20572354 GCAGGTAGCTAGGAGCGGGAAGG - Intronic
1163968353 19:20769571-20769593 GCAGGTAGCTAGGAGCGGGAAGG + Intronic
1164254737 19:23517505-23517527 CCAAGTGGCCGGGGGTGGGGGGG + Intergenic
1164655157 19:29915607-29915629 CCAGTTGGGTGGGGGTGGGGGGG + Intergenic
1164694625 19:30234007-30234029 CCAGGTAGGTGGTGGCAGGAAGG + Intronic
1164718238 19:30409447-30409469 CAAGGAAGCTGGGAGCAGGGGGG - Intronic
1165043449 19:33085333-33085355 CCTGGTTACTGGGGGCTGGGGGG - Intronic
1165105088 19:33464504-33464526 GCAGGTGGGTGGGGGTGGGGAGG - Intronic
1165510974 19:36266539-36266561 GCAGGTTGCTGGGACCGGGGCGG - Intergenic
1165668735 19:37656101-37656123 CCAGGTACGCGGGGGCGCGGCGG - Intronic
1165732127 19:38152603-38152625 CCAGGGAGCTGGTGGCGGCGGGG - Intronic
1165797554 19:38527781-38527803 CCAGGTGGGTGGGGCCGGAGGGG + Exonic
1165830499 19:38728149-38728171 CCAGGGAGATGTGGGCAGGGAGG - Intronic
1165832431 19:38736311-38736333 CCCAGCAGCTGGGGACGGGGCGG + Exonic
1165906614 19:39198132-39198154 CCAGGTTGCTGAGGGTGGGGAGG + Intronic
1166365895 19:42278297-42278319 GCAGGAAGCTGGGAGCTGGGAGG - Intronic
1166678497 19:44753813-44753835 GCAGGAAGGCGGGGGCGGGGGGG + Intronic
1167040635 19:47020895-47020917 GCAAGGAGCTGGGGGGGGGGGGG - Intronic
1167635871 19:50655259-50655281 CCAGTTAGCTGATGGTGGGGTGG + Intronic
1168232973 19:55044997-55045019 CCAGGAAGCTGCGGGCATGGCGG + Exonic
1168241831 19:55092537-55092559 CCAGGGTGCTGGGGCAGGGGAGG + Exonic
1168277029 19:55284255-55284277 CCGCGGAGCTGGGGGAGGGGGGG - Exonic
1168404003 19:56101367-56101389 CCAGGCAGCTGGCTCCGGGGAGG - Intronic
1168489562 19:56796662-56796684 CCAGGCAGTGGGGGGTGGGGAGG + Intronic
925151034 2:1615069-1615091 CCAGGTTGCTGGGAGAGGTGAGG + Intergenic
925830006 2:7884471-7884493 CCAGGAGCCTGGGGGTGGGGAGG + Intergenic
925922096 2:8645085-8645107 CCAGGGAGCGTGGGGCGGAGGGG - Intergenic
926052257 2:9752728-9752750 TCAGGAAGCTGGGGGTGCGGTGG + Intergenic
926071583 2:9897983-9898005 GATGGTAGCTGGGGGCGGGGTGG - Intronic
926274584 2:11393948-11393970 TCAGGGAGCTGGGGTGGGGGTGG - Intergenic
926914379 2:17878612-17878634 CCCGGGAGCTGCGGGCGGGGCGG - Intronic
927697948 2:25250808-25250830 GCAGGTAGCAGTGGGCGGGAAGG + Intronic
928513020 2:32019241-32019263 CCAATTAGCTGGGTGCGGTGGGG - Intronic
928546633 2:32334933-32334955 CCAGCTACTCGGGGGCGGGGCGG + Intergenic
928671006 2:33603410-33603432 CCATGTAGCAGGGGTCGGAGTGG - Intergenic
929626237 2:43410720-43410742 CCAGGGAGGTGGGGGAGGGGAGG + Intronic
930124220 2:47783490-47783512 CCAGGTAGCGGGGTGGGGGTGGG + Exonic
931312618 2:61096479-61096501 CTAGGCAGCTGGGGGCTGGTGGG - Intronic
931546869 2:63397975-63397997 CAAGATAGATGGGGCCGGGGAGG + Intronic
931809473 2:65840930-65840952 CCAGGAGGTTGGGGGTGGGGTGG - Intergenic
932114620 2:69035148-69035170 GAAGGCAGCGGGGGGCGGGGTGG + Intronic
932498754 2:72161565-72161587 CAAGGTTGACGGGGGCGGGGTGG - Intergenic
932586942 2:73036339-73036361 CCAGGAGGCTGGGGGAAGGGAGG + Intronic
933354618 2:81196488-81196510 CCAGGTAGCTGGGCTCCGGGGGG + Intergenic
933722832 2:85409303-85409325 CCATGGGGCTGGGGGAGGGGAGG + Intronic
933895607 2:86807820-86807842 GCAGGGAGCTGGGGGAAGGGCGG + Intronic
934260971 2:91477360-91477382 CGAGGCGGCGGGGGGCGGGGGGG - Intergenic
934857909 2:97740180-97740202 CCAGCTGGATGGGGGAGGGGGGG - Intergenic
934942512 2:98512789-98512811 CCAGGGTGCTGGGGGCCTGGTGG + Intronic
934943720 2:98520983-98521005 ACAGGTGGCTGGGGACAGGGAGG + Intronic
934945619 2:98539275-98539297 GCAAGCAGCTGGGGGCAGGGAGG - Intronic
935736679 2:106111930-106111952 CCGGGGAGCTGGGGGTGGGAGGG + Intronic
936153758 2:110035515-110035537 CCAGGGAGCAGGAGGTGGGGAGG - Intergenic
936190927 2:110335900-110335922 CCAGGGAGCAGGAGGTGGGGAGG + Intergenic
937134965 2:119544519-119544541 CCAGGGACCTGGGGCCCGGGTGG + Intronic
937347118 2:121132989-121133011 CCTGATAGCTGGGGTGGGGGTGG - Intergenic
938089664 2:128423102-128423124 TCTGGAGGCTGGGGGCGGGGTGG + Intergenic
938099191 2:128486614-128486636 CCGCGTGGCCGGGGGCGGGGTGG + Intergenic
938157458 2:128953299-128953321 ATGGGTGGCTGGGGGCGGGGAGG + Intergenic
939105322 2:137942187-137942209 CCAGGAGGCTGGGGGTGGAGAGG + Intergenic
939148439 2:138444595-138444617 CTAGTGAGCTGGGGGTGGGGTGG - Intergenic
939800107 2:146697851-146697873 AAAGGTGGCGGGGGGCGGGGGGG + Intergenic
942268189 2:174248507-174248529 GCCGGCAGCTGGAGGCGGGGAGG + Exonic
942457956 2:176150893-176150915 CCATGTAGCTGGGGGTGGGCTGG - Intergenic
942891125 2:180990160-180990182 CCTGGTGGCTGGGGAAGGGGAGG - Intronic
943185143 2:184598253-184598275 CCTGGAAGGTGGGGGCGGAGAGG - Intergenic
943767597 2:191678804-191678826 CCACGTGGGTGGGGGAGGGGAGG - Intronic
944868447 2:203884957-203884979 GCAGGTTGCTGGGGTGGGGGTGG + Intergenic
945955738 2:216084170-216084192 CCAGGCAGATGGGGTGGGGGAGG - Intronic
945965186 2:216179415-216179437 ACAGGAATGTGGGGGCGGGGTGG + Intronic
947407158 2:229790525-229790547 GCAGGGAGCAGGGGGAGGGGGGG + Intronic
947852803 2:233302001-233302023 CAGGGGAGGTGGGGGCGGGGTGG - Intergenic
947865787 2:233397194-233397216 CAGGGTGGCTGGGGGGGGGGGGG + Intronic
947934130 2:233988715-233988737 CCACCTAGCTGGTGGCAGGGAGG + Intronic
948389195 2:237599932-237599954 CCAGGCTGCTCGGGGCAGGGAGG - Intronic
948473837 2:238203761-238203783 CGGGGCGGCTGGGGGCGGGGCGG + Intergenic
948560213 2:238847259-238847281 CCGGGTTGCTGGGCGCGGGTTGG - Intergenic
948753394 2:240145029-240145051 CCAGGGGGATGGGGGCGGGGTGG - Intergenic
948837161 2:240631392-240631414 CCAGGTGGGTGGGGGTGGGAAGG - Intergenic
948850679 2:240703931-240703953 CCAGGGAGCTGAGGGTTGGGTGG - Intergenic
949070357 2:242020777-242020799 CCGTGTAGCTGGAGGCGCGGTGG + Intergenic
949080099 2:242089284-242089306 CCAGGAGGGTGGGGGCGGGAAGG - Intergenic
1168766073 20:382024-382046 CCTGGCTGCGGGGGGCGGGGCGG + Intronic
1170570140 20:17628055-17628077 CCAGGGAGGTGGGGGAGGTGTGG - Intronic
1170781724 20:19431288-19431310 CAAGGGAGCTGGGGGAGGGTTGG + Intronic
1172028871 20:31968005-31968027 TCAGGCGGGTGGGGGCGGGGCGG + Exonic
1172505095 20:35455538-35455560 ACAGGGAGCGAGGGGCGGGGGGG - Exonic
1172613671 20:36269201-36269223 GCAGGGAGCTGGTGGGGGGGGGG + Intronic
1172944092 20:38674558-38674580 CCGGGGCTCTGGGGGCGGGGTGG - Intergenic
1173197275 20:40926143-40926165 CCAAGTAGATGGAGCCGGGGTGG - Intergenic
1173278452 20:41604921-41604943 ACAGGGAGTTGGGGGTGGGGAGG + Intronic
1173304107 20:41831566-41831588 CCAGGGAGATGGGGGAGGAGTGG + Intergenic
1173387594 20:42603348-42603370 CCAGGGGGCTAGGGGTGGGGTGG + Intronic
1173548214 20:43914987-43915009 CAAGGTAGGCGGGGGCGGGCGGG + Exonic
1173571047 20:44076322-44076344 CCTGGTAGGTGGCGGGGGGGGGG - Intergenic
1173622921 20:44450220-44450242 CTGGGTAGCTGGGGTCGGGGTGG + Intergenic
1174149905 20:48478562-48478584 CCAGGGAACTGAGGCCGGGGAGG - Intergenic
1174327371 20:49790043-49790065 CCAGGAAGCTCTGGTCGGGGAGG - Intergenic
1174460382 20:50678278-50678300 CCAGGAACCTGGGGGCTGGGTGG + Intronic
1175171245 20:57082777-57082799 CCAGGGATCTGGGGGCAGGGAGG + Intergenic
1175391639 20:58631350-58631372 CCAGGGAGGTGGGGGTGGGCAGG + Intergenic
1175759222 20:61550041-61550063 CCAGGGAGGTTGGGGCAGGGAGG - Intronic
1175944422 20:62552035-62552057 CCAGGGAGCTGGGGACGTTGAGG + Intronic
1176088763 20:63309780-63309802 CCAGGCTGGTGGGGGCAGGGAGG - Exonic
1176105111 20:63382217-63382239 GGAGAGAGCTGGGGGCGGGGAGG + Intergenic
1176309712 21:5143041-5143063 GCAGACAGCTGGGGGAGGGGAGG + Intronic
1176428992 21:6564717-6564739 TCCGAGAGCTGGGGGCGGGGAGG + Intergenic
1176715117 21:10343445-10343467 CCGGGGATCTGGGGGCGAGGTGG + Intergenic
1176836954 21:13801873-13801895 CCAGGGGGCTGGGGGCAGAGAGG + Intergenic
1176938265 21:14892555-14892577 CCAGGGAGCGGGGTGTGGGGAGG + Intergenic
1178077400 21:29024586-29024608 CCCGGGAGGTGGGGGTGGGGTGG + Intergenic
1178878167 21:36428500-36428522 CCAGCTATTTGGGGGTGGGGGGG - Intergenic
1178935766 21:36860263-36860285 CCAGCTAGTTAGTGGCGGGGCGG + Intronic
1178953856 21:37006506-37006528 CCAGGGAGCCGGGGATGGGGAGG - Intronic
1179152678 21:38822241-38822263 CAAGGGAACTGGAGGCGGGGTGG - Intronic
1179198110 21:39184071-39184093 CCAGGTAGGTGGCGGCGCGGTGG + Intergenic
1179248681 21:39655422-39655444 GCAGGGAGCTGGGTGCCGGGAGG + Intronic
1179704481 21:43173033-43173055 TCCGAGAGCTGGGGGCGGGGAGG + Intergenic
1179786463 21:43733258-43733280 CCAGGGCGGGGGGGGCGGGGGGG - Intronic
1179847346 21:44118992-44119014 GCAGACAGCTGGGGGAGGGGAGG - Intronic
1179893631 21:44350015-44350037 CCAGGTCTCTGGGGGAGGGCGGG + Intergenic
1180007940 21:45031869-45031891 CCAGGCTGCGGGGGGTGGGGAGG + Intergenic
1180090400 21:45531144-45531166 CCACGGGGCAGGGGGCGGGGAGG + Intronic
1180090422 21:45531188-45531210 CCACGGGGCAGGGGGCGGGGAGG + Intronic
1180121324 21:45750399-45750421 CCAGGAAGAAGGGGGGGGGGGGG - Intronic
1180565047 22:16656421-16656443 TCAAGAAGCTGGGGGAGGGGGGG - Intergenic
1180603228 22:17036493-17036515 CCGGGGATCTGGGGGCGGGGTGG - Intergenic
1180841913 22:18963137-18963159 TCAGGTCGCTGGGGATGGGGTGG - Intergenic
1180904801 22:19401967-19401989 CCTGGGAGCTGGGGCGGGGGAGG - Intronic
1181059586 22:20275744-20275766 TCAGGTCGCTGGGGATGGGGTGG + Intronic
1181077918 22:20393800-20393822 CCACGTAGCTGGGAGTCGGGTGG - Intergenic
1181106942 22:20581273-20581295 CCAGGCAGCAGAGGGCAGGGTGG - Intronic
1181467341 22:23117292-23117314 CCAGGTGGCTGCAGGCGGGATGG + Intronic
1181496465 22:23289935-23289957 GCAGGTAGCTGGAGGAGAGGAGG - Intronic
1182100621 22:27655110-27655132 CCAGGTACCTGGGGGAAGGTTGG - Intergenic
1182549498 22:31093291-31093313 CCAGCTGGCTGGTGGCGGGCTGG + Intronic
1182574334 22:31262723-31262745 CCAGGGTGCTGAGGGCGTGGGGG - Exonic
1183010722 22:34944426-34944448 CATGGTGGCGGGGGGCGGGGGGG - Intergenic
1183299425 22:37051711-37051733 CCCGGGCGCTGGGGGCGGGCGGG - Intergenic
1183307136 22:37088598-37088620 GCAGGTGGTTGGGGGTGGGGAGG - Intronic
1183315211 22:37133284-37133306 GCAGGGAGCTGTGGGCGGAGGGG + Intronic
1183471504 22:38009402-38009424 CCAGGGAGCTGGGGGTGGCCTGG + Intronic
1183511688 22:38239160-38239182 GCAGGCAGATGGGGGCAGGGTGG - Intronic
1183543285 22:38442094-38442116 GCAGGTGGCTGGGGACAGGGTGG + Intronic
1183613512 22:38927304-38927326 TCAGGCTGCCGGGGGCGGGGGGG + Intergenic
1183623258 22:38986925-38986947 CTGGGTGGCTGGGGACGGGGGGG + Intronic
1183720252 22:39558061-39558083 CAAGGTAGGTGGGGGCTGGGTGG + Intergenic
1184035897 22:41917938-41917960 ATTGGGAGCTGGGGGCGGGGCGG - Intergenic
1184669689 22:46006244-46006266 GCAGGAAGCTGGGGCCGGAGAGG - Intergenic
1184698060 22:46150649-46150671 CCAGGTGCCCGGGGGCGGGCGGG + Intronic
1184981170 22:48096968-48096990 CCAGATGGCAGGGGGCAGGGAGG - Intergenic
1185012576 22:48322535-48322557 CCAGGTGTCTGGGGGGCGGGAGG + Intergenic
1185082152 22:48715456-48715478 CGAGGAGGCTGGGGGTGGGGCGG + Intronic
1185147991 22:49149711-49149733 GGAGGGAGATGGGGGCGGGGAGG + Intergenic
1185233639 22:49698881-49698903 CCAGGCAGCTGTGGACAGGGAGG + Intergenic
1185233647 22:49698908-49698930 CCAGGCAGCTGTGGACAGGGAGG + Intergenic
1185233655 22:49698935-49698957 CCAGGCAGCTGTGGACAGGGCGG + Intergenic
1185233663 22:49698962-49698984 CCAGGCAGCTGTGGACAGGGAGG + Intergenic
1185233671 22:49698989-49699011 CCAGGCAGCTGTGGACAGGGAGG + Intergenic
1185233679 22:49699016-49699038 CCAGGCAGCTGTGGACAGGGCGG + Intergenic
1185233932 22:49700149-49700171 CCAGGCAGCTGTGGACAGGGCGG + Intergenic
1185251032 22:49801843-49801865 CCAGGCAGCTGGGGGTGGCCTGG - Intronic
1185281715 22:49972534-49972556 ACAGGAGGCTGGGGGCGGTGGGG - Intergenic
1185321576 22:50202446-50202468 GCAGGTCGCTGGGGGTGGGGAGG - Intronic
1185323752 22:50215626-50215648 CCAGGGGGGTGGGGGGGGGGGGG + Intronic
1185388585 22:50547502-50547524 GCCGGGAGCTGCGGGCGGGGAGG - Intergenic
1185417882 22:50720133-50720155 CCAGGGCGCTGGGCGGGGGGTGG - Intergenic
949630456 3:5920242-5920264 CCAGGACTTTGGGGGCGGGGGGG + Intergenic
949891545 3:8737185-8737207 CCAGGTGGCAGGTGGCAGGGTGG + Intronic
949932840 3:9092841-9092863 CGAGGTAGCTGGGGATGGTGTGG + Intronic
950177203 3:10883043-10883065 CAAGGGGGCGGGGGGCGGGGAGG + Intronic
950573933 3:13819505-13819527 CCAGATAGGTGGGGCAGGGGTGG - Intronic
952215191 3:31271392-31271414 CCAGGTAGCTGTGGGAGGCAGGG + Intergenic
952354247 3:32570297-32570319 CCGGGCCGCTGGGGGCCGGGCGG + Intronic
952601498 3:35088916-35088938 GCAGGTAGCTGGGGTGGGGTGGG + Intergenic
952723219 3:36555071-36555093 ACAGGCAGCTGGGGGATGGGGGG + Intergenic
953311499 3:41884969-41884991 CCAGCTAGCTGGGGGGGTTGAGG - Intronic
953329848 3:42043606-42043628 CCATGGAGCTGGGGGGGGGGCGG + Intronic
953605347 3:44410053-44410075 CAGGGAAGCTGGGGGTGGGGCGG - Intergenic
953901928 3:46848437-46848459 CCAGGGAGATTGGGGCAGGGAGG + Intergenic
953996618 3:47524685-47524707 ACCGGTAGCTGGGAGCCGGGTGG - Intergenic
954041408 3:47890665-47890687 ACAGGGAGCTGAGGGCTGGGTGG + Intronic
954150792 3:48656088-48656110 GCGGGTAGGTGGGGGCGGCGGGG + Intronic
954645561 3:52129571-52129593 TCTGGTAGCTGGGGGCAGGCCGG - Intronic
954715574 3:52525136-52525158 GCCAGTTGCTGGGGGCGGGGGGG + Intronic
954779085 3:53046103-53046125 CCGCGGAGCTGGGGGTGGGGGGG - Intronic
955656631 3:61251286-61251308 CCTGGAAGGTAGGGGCGGGGAGG - Exonic
956167569 3:66408033-66408055 CCACGTGGATGGGGGCAGGGAGG - Intronic
956845067 3:73175087-73175109 CAAGGGGGCTGGGGGCAGGGTGG - Intergenic
958917401 3:100064871-100064893 CCAGGGGCCTGGGGGTGGGGTGG + Intronic
960296230 3:115947886-115947908 CCAGGTAGCTGGCTGATGGGAGG + Intronic
960845439 3:122000479-122000501 CAAGGTATGTGGGAGCGGGGAGG - Intronic
961123916 3:124398868-124398890 CGAGGTAGCAGGGGGCCAGGAGG + Exonic
961512164 3:127409689-127409711 CCATGCAGCTGTGGGCTGGGAGG - Intergenic
961525817 3:127496728-127496750 CATGGTCGGTGGGGGCGGGGGGG - Intergenic
962332059 3:134486523-134486545 CCAGGTGGCTGGGGGCGCTTCGG + Intronic
962800089 3:138882925-138882947 CCAGGTAGCTGGGACCATGGAGG + Intergenic
966003179 3:174975547-174975569 CAAGGTAGGTGGGGGGGCGGCGG - Intronic
966893589 3:184426099-184426121 CCCAGAAGCTGGGGGTGGGGTGG + Intronic
966925278 3:184640549-184640571 CCAGGGAGATGGGGTAGGGGTGG - Intronic
967239142 3:187419168-187419190 CCAGTTGGCTGGGCGAGGGGAGG + Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968230861 3:197003728-197003750 CCAGGAGGCTGCGGGCCGGGAGG - Intronic
968521103 4:1035198-1035220 CCAGGGACCTGGGGTCAGGGAGG + Intergenic
968701179 4:2059007-2059029 CGTGGGAGCGGGGGGCGGGGCGG + Intergenic
968850209 4:3073710-3073732 CCAGCTCACTGGGGGTGGGGTGG + Intergenic
968905150 4:3447439-3447461 CCCGGTGGCTGGGGGAGGGCTGG + Intronic
969014741 4:4096449-4096471 CCTGTTAGCAGGGGGCTGGGGGG + Intergenic
969240247 4:5892612-5892634 GCAGGTCGCGGGGCGCGGGGCGG + Exonic
969300694 4:6295262-6295284 CCAGGAAGCTGCAGGTGGGGAGG + Intronic
969617960 4:8264824-8264846 CCAGGTAGCATGGGACGGGGTGG + Intergenic
970142943 4:13002526-13002548 CCTAGGAGCTGGGGGCAGGGAGG - Intergenic
971487719 4:27177077-27177099 TCAGGAAGCTGGGGGCGGCTGGG + Intergenic
972739606 4:41877823-41877845 CCTGGTAGCTGGGGTGGGAGTGG - Intergenic
975632831 4:76419865-76419887 CCATCTAGCTGGGGGACGGGTGG + Intronic
976194935 4:82523219-82523241 CCAGAGGGATGGGGGCGGGGGGG + Intronic
976379198 4:84380047-84380069 CCAGGGGTCTGGGGGTGGGGTGG - Intergenic
979274826 4:118803407-118803429 CTAGGGAGATGGGGGAGGGGAGG - Intronic
980977068 4:139621361-139621383 CCAGGAAGATGGGGACTGGGGGG - Intergenic
981279143 4:142936848-142936870 CCAGGTACTGGGGGGCTGGGGGG + Intergenic
982070021 4:151686657-151686679 CCAGGAAACTGGGGGGTGGGGGG - Intronic
983266008 4:165508636-165508658 CAAGGTAGTGGGGGGCAGGGAGG + Intergenic
983641164 4:169945097-169945119 CCAGGTAGCTGGGAGGGTAGTGG + Intergenic
983656341 4:170089242-170089264 CCAGGTAAATGGGAGAGGGGTGG - Intronic
983938432 4:173518841-173518863 GCGGGGAGCAGGGGGCGGGGGGG - Intergenic
984854848 4:184186393-184186415 GCAGTTTTCTGGGGGCGGGGTGG + Intronic
985587975 5:750779-750801 CCATGTAGCTGTGGGAGGGTGGG - Intronic
985714261 5:1446583-1446605 CGGGGGAGCGGGGGGCGGGGAGG - Intergenic
985781112 5:1872342-1872364 CCAGGCCACGGGGGGCGGGGGGG - Intergenic
985824742 5:2183837-2183859 GGAGGCTGCTGGGGGCGGGGAGG + Intergenic
986682911 5:10250122-10250144 CCAGGAAGCCGGGGAGGGGGAGG - Exonic
986696493 5:10360728-10360750 CCAGGTAGCTGGGTGGTGGTGGG + Intronic
986710627 5:10485854-10485876 CCAGGTCGCGGGGTGGGGGGGGG + Intergenic
986746535 5:10749898-10749920 CCACATAGCTGAGGGCGTGGAGG - Intronic
987084647 5:14457386-14457408 CCTAGTACCGGGGGGCGGGGCGG - Intronic
989261558 5:39424698-39424720 AAGGGTAGCGGGGGGCGGGGGGG + Intronic
990369382 5:55101950-55101972 GCAGGAAGCAGGGGTCGGGGGGG + Intergenic
991506714 5:67332523-67332545 CAAGGAACCTGGGGGTGGGGAGG - Intergenic
992007320 5:72490711-72490733 TCTGGTAGCTGGGGGTGGGCAGG - Intronic
992753584 5:79883446-79883468 CCACGAAGCTGGGGGTGGTGGGG + Intergenic
993900210 5:93579761-93579783 CCAGCCGGCTGGGGGCGGGGAGG - Intergenic
997367362 5:133334719-133334741 CTAGGTACATGGGGGAGGGGTGG + Intronic
997376733 5:133402916-133402938 CAAGGTTGATGGTGGCGGGGAGG + Intronic
997584094 5:135034447-135034469 CGAGGCCGCGGGGGGCGGGGAGG - Intronic
997590098 5:135067124-135067146 CCAGGGAGGAGGGGTCGGGGAGG - Intronic
997789994 5:136750375-136750397 CCAGGAAGCTTGGGGTGGGATGG - Intergenic
997938921 5:138139095-138139117 CCAGGCAGCAGAGGGCGGTGGGG + Intronic
998157248 5:139794020-139794042 ACAGGTAGCAGAGGGCAGGGGGG + Intergenic
999317843 5:150595847-150595869 CCAGCCAGCTGGGGGGGTGGGGG - Intergenic
999376104 5:151087355-151087377 CCAGGGAGTTGGGGTTGGGGGGG + Intronic
999474582 5:151886915-151886937 CCAGGTGCTTGGGGGTGGGGTGG - Intronic
1001177554 5:169486271-169486293 TCATGTTGCTGGGGGTGGGGAGG - Intergenic
1001381527 5:171309476-171309498 CCAGGTAGCTGGCGCCGTCGGGG - Exonic
1002001057 5:176196489-176196511 CCTGGGAGGTGGGGGCGGGGGGG - Intergenic
1002074967 5:176703035-176703057 ACAGGCAGCAGGGGGTGGGGTGG - Intergenic
1002133564 5:177095433-177095455 CCAGGAAGGTGGGGCCGAGGCGG + Exonic
1002201553 5:177531514-177531536 GCGGGTGGCTGGGGGTGGGGGGG + Intronic
1002253278 5:177942483-177942505 CCTGGGAGGTGGGGGCGGGGGGG + Intergenic
1002857417 6:1050629-1050651 CCAGGTAGCTGAACGGGGGGAGG - Intergenic
1003004144 6:2365262-2365284 TCAGGGAGCGGGGGGCAGGGGGG - Intergenic
1003183061 6:3808264-3808286 CCAGGTGGGTGGGGAGGGGGAGG + Intergenic
1003410414 6:5857016-5857038 GCCGGGAGCTGGGGGCAGGGGGG - Intergenic
1003552258 6:7109253-7109275 GCGGGAAGTTGGGGGCGGGGGGG - Intronic
1003604107 6:7543159-7543181 ACAACTAGCAGGGGGCGGGGAGG - Intronic
1005999779 6:30955856-30955878 CCTGGGGGCTGGGGGCTGGGAGG - Intergenic
1006121851 6:31811840-31811862 CCACGTAGCTGGGGGTGGTGCGG + Exonic
1006122505 6:31815861-31815883 CCACGTAGCTGGGGGTGGTGCGG - Exonic
1006124368 6:31828055-31828077 CCACGTAGCTGGGGGTGGTGCGG - Exonic
1006403176 6:33829619-33829641 CCAGGGAGGTGAGGGAGGGGAGG - Intergenic
1006403209 6:33829726-33829748 CCAGGGAGGTGAGGGAGGGGAGG - Intergenic
1006425434 6:33960210-33960232 CCCAGTAGCTGGGGGAGGGAGGG - Intergenic
1006470766 6:34227423-34227445 GTGGGTAGCTGGGGGAGGGGAGG - Intergenic
1006554395 6:34853029-34853051 CCAGGAGGCTGGGGGTGGGGTGG + Intronic
1006568673 6:34981983-34982005 CCAGGTAGCAGGGCGGGTGGGGG + Exonic
1006634420 6:35452141-35452163 CCAGGGAGCCTGGAGCGGGGCGG - Intergenic
1006671298 6:35731473-35731495 CAAGGCAACTGGGGGCGGGACGG - Intergenic
1007093550 6:39199658-39199680 CCAGGCAGATGGAGGCAGGGAGG - Intronic
1007286971 6:40754861-40754883 CCAGGTGTCTGGGGGCAGGGAGG + Intergenic
1007363446 6:41374115-41374137 CCGTGTGGCTGGGGGAGGGGTGG + Intergenic
1007603237 6:43096902-43096924 CCAGTTTGCTGGGGGCCTGGAGG + Intronic
1007746158 6:44044086-44044108 GCTGGGAGCTGGGGGAGGGGGGG - Intergenic
1010404179 6:75483868-75483890 CCTGCTTGCTGGGGGCTGGGGGG + Intronic
1011000671 6:82584442-82584464 CCACGGAGCTGGGGTGGGGGTGG + Intergenic
1011264010 6:85497033-85497055 CCAGGAGGCCAGGGGCGGGGTGG - Intergenic
1011410182 6:87059634-87059656 CCAGGGAGGTGGGGGGAGGGGGG + Intergenic
1012525504 6:100172269-100172291 CCATTTAGCTGGGGGTGAGGAGG + Intergenic
1013097987 6:106963296-106963318 CATGGTAACTGGGGGAGGGGAGG - Intergenic
1014802241 6:125790565-125790587 GGAGGTCGCGGGGGGCGGGGAGG + Intronic
1015541413 6:134317796-134317818 CCAGGTAGCTGGGGGCGGGGAGG - Exonic
1016060648 6:139626531-139626553 GCAGGAAGCTGGGGGAGGAGTGG - Intergenic
1017041678 6:150313327-150313349 TCTGGTGGCTGGGGGCAGGGAGG - Intergenic
1017809428 6:157974354-157974376 GCAGGTGGCTGGGGGTGGAGCGG - Intergenic
1018027290 6:159816203-159816225 CCAGGCAGCAGGGGAGGGGGAGG + Intronic
1018934380 6:168263934-168263956 ACAGGGAGATGGGGGCTGGGGGG - Intergenic
1018950664 6:168376925-168376947 CCAGGAAGTGGGGGGCGGTGAGG - Intergenic
1019402971 7:866778-866800 CCAGGGAGAAGGGGGCGGGGAGG - Intronic
1019421851 7:954377-954399 CCGGGTAGGTGTGGGCCGGGTGG - Intronic
1019456588 7:1130708-1130730 CCGGGCGGGTGGGGGCGGGGGGG + Intronic
1019460174 7:1154041-1154063 CCAGGAAGCAGGGAGCGGGAGGG + Intronic
1019477935 7:1252914-1252936 CCACGTAGAGGAGGGCGGGGCGG + Intergenic
1020059753 7:5143580-5143602 CCGTGAGGCTGGGGGCGGGGTGG - Intergenic
1020150782 7:5680286-5680308 AGAGCTAGCTGGGGGCAGGGCGG - Intronic
1020168218 7:5824167-5824189 CCGTGAGGCTGGGGGCGGGGTGG + Intergenic
1020204667 7:6105242-6105264 CCAGGCCGCTGGGGAGGGGGCGG + Intronic
1021084196 7:16402119-16402141 AAAGGTAGCTGGGGCAGGGGAGG + Intronic
1021163112 7:17299398-17299420 GCAGGGATTTGGGGGCGGGGTGG - Intronic
1021537676 7:21723747-21723769 CCCTGTAGCTGGGGGTGGAGGGG - Intronic
1021710150 7:23407945-23407967 GCAGGGGGCGGGGGGCGGGGGGG + Intronic
1022008997 7:26292422-26292444 CCGGGTAGAAGGGGGTGGGGAGG + Intronic
1023059373 7:36313593-36313615 CCAGGCAGTTGGGAGCGGGTGGG + Intergenic
1023327213 7:39073478-39073500 CCAAGGAGATGGGGGTGGGGAGG - Intronic
1023844227 7:44112080-44112102 CCAGGCAGCTGGGGGTTGTGGGG + Intronic
1025126084 7:56346200-56346222 CAAAGTTGCGGGGGGCGGGGGGG + Intergenic
1025201836 7:56966915-56966937 CCATGTGGCTGGGGTTGGGGAGG + Intergenic
1025249890 7:57344550-57344572 TCAGGTAGCTGGGCGGGGGTTGG + Intergenic
1025670110 7:63610013-63610035 CCATGTGGCTGGGGTTGGGGAGG - Intergenic
1025734522 7:64135278-64135300 CCAGGCAGCTGGGAGCCTGGGGG + Intronic
1026818635 7:73531562-73531584 CCAAAAAGCTGGGGGGGGGGGGG + Intergenic
1026979808 7:74519634-74519656 CCAGGTCGCTGGGGGCAAGGGGG - Exonic
1027232928 7:76282583-76282605 AAAGGGGGCTGGGGGCGGGGAGG - Intronic
1028033658 7:85950650-85950672 CAGGGTAGATGGGGGAGGGGTGG + Intergenic
1028530263 7:91830963-91830985 ATAGGTAGCTGGGAGTGGGGTGG - Intronic
1028635279 7:92981863-92981885 CCAGGGATTTGGGGGTGGGGTGG - Intergenic
1029384061 7:100232048-100232070 CCACCTGGCAGGGGGCGGGGTGG + Intronic
1029423378 7:100483307-100483329 CCTGGCACCTGGGGGCGGTGGGG + Intergenic
1030156592 7:106461482-106461504 CCAGAAAGGTGAGGGCGGGGGGG + Intergenic
1030817089 7:114051521-114051543 GAAGGTGGGTGGGGGCGGGGGGG + Intronic
1031051981 7:116953858-116953880 CCGGGCAGCTGGGCGCGCGGGGG + Intronic
1031805294 7:126300476-126300498 TAAGGTAGGTGGTGGCGGGGTGG - Intergenic
1032263013 7:130351626-130351648 AGAGGGAGCTGGGGGTGGGGTGG + Intronic
1032342679 7:131090154-131090176 TCAGGTAGCTGGGGGACAGGTGG - Intergenic
1034085875 7:148322033-148322055 CCAGCTAGTTGGGGTGGGGGAGG - Intronic
1035212175 7:157336824-157336846 CCAGGAGACTGGGGGCGAGGGGG - Intronic
1035265839 7:157690031-157690053 GCAGGGTGCTGGGGGTGGGGGGG - Intronic
1035266827 7:157693729-157693751 CGAGGTCGCCGCGGGCGGGGAGG - Intronic
1035295865 7:157866861-157866883 CCAGGGCGTCGGGGGCGGGGTGG - Intronic
1035295878 7:157866895-157866917 CCAGGGCGTCGGGGGCGGGGTGG - Intronic
1035295891 7:157866929-157866951 CCAGGGCGTCGGGGGCGGGGTGG - Intronic
1035346958 7:158206551-158206573 CCAGGAAGCTCGGGGAGGGGGGG + Intronic
1035538142 8:407547-407569 CCAGGAGGGTGGGGGCGGGAAGG - Intronic
1035602157 8:902970-902992 TCGGGTGGGTGGGGGCGGGGGGG + Intergenic
1036060397 8:5311917-5311939 GGTGGTAGCCGGGGGCGGGGTGG - Intergenic
1036165550 8:6429494-6429516 CCTGGCAGCTGGGGCGGGGGAGG - Intronic
1036645354 8:10608907-10608929 CCAGGGAGCTGAGGGAGGGCTGG - Exonic
1036708031 8:11059605-11059627 GCAGGGCGCTGGGGGCGCGGGGG + Intronic
1036773227 8:11592839-11592861 CCAGGTGGCTGGGGTGAGGGAGG + Intergenic
1037705895 8:21314713-21314735 GCAGGAGGCTGGGGGCGGGGAGG + Intergenic
1037828881 8:22176871-22176893 CCAGGCTGCCGGGGGCGGGGCGG - Intronic
1038449903 8:27633532-27633554 CCAAGTGGCTGGGGCAGGGGTGG - Intergenic
1038491655 8:27976136-27976158 AGAGGAAGCTGGGGGAGGGGAGG + Intronic
1038682416 8:29681303-29681325 CCAGGTGGTTGGGGGCAGGGTGG - Intergenic
1039385506 8:37132074-37132096 GCAGGTGGCGGGGGGTGGGGGGG - Intergenic
1039783762 8:40814000-40814022 GCAGGGGGCTGGGGACGGGGTGG + Intronic
1039998563 8:42557077-42557099 CCAAATAGTTGGGGGTGGGGGGG - Intergenic
1040501465 8:48008689-48008711 CCGGCGGGCTGGGGGCGGGGTGG + Intronic
1040567612 8:48581863-48581885 CCAGCCAGCTCGGGGCGGGCTGG - Intergenic
1040984013 8:53273221-53273243 GCAGGTAACTGGGGGCGAGAAGG + Intergenic
1042864566 8:73345785-73345807 CCAGGCAGCTGTGGTCTGGGGGG + Intergenic
1042880020 8:73477088-73477110 CCGGGTAGGTGGGGGTGGAGTGG + Intronic
1042926377 8:73972142-73972164 GCAGGCAGCTGGGGGTGGGGGGG - Intronic
1043155759 8:76776920-76776942 CCAGGGAGGTGGGGGAGGGAAGG + Intronic
1043416136 8:80052258-80052280 CCAGGTAGCTGGGAAGGAGGTGG - Intronic
1044340459 8:91040897-91040919 GCAGGAAGCGGGGGGAGGGGAGG + Exonic
1045055818 8:98367594-98367616 CCAGGTACCTGGGGCTGGAGCGG + Intergenic
1045443604 8:102238974-102238996 CCCTAGAGCTGGGGGCGGGGCGG - Exonic
1047453938 8:124991874-124991896 CCAGGTAGCTAGGGGCCAGCTGG + Intergenic
1048142221 8:131805441-131805463 CCTGTCAGCTGGGGGCAGGGTGG - Intergenic
1048886552 8:138914162-138914184 TCAGGGGGCTGGGAGCGGGGAGG + Intergenic
1048965080 8:139609244-139609266 CTAGGTAGGTGGGGGGGGGGTGG - Intronic
1049194381 8:141307729-141307751 CCGAGGAACTGGGGGCGGGGAGG + Intronic
1049488108 8:142876874-142876896 CCAAGTTGCTGGCTGCGGGGAGG + Exonic
1049537577 8:143189507-143189529 CCACGGGGGTGGGGGCGGGGAGG - Intergenic
1049565282 8:143334915-143334937 GCTGGCCGCTGGGGGCGGGGCGG - Intronic
1049788314 8:144461881-144461903 CCAGGGAGCTTGGGACCGGGTGG + Intronic
1050472630 9:6008262-6008284 GCAGGTAGAGGGGGGCGGGAGGG - Intergenic
1051418941 9:16871302-16871324 CCGGGGAGCTGCGGGCGTGGAGG + Intergenic
1051608129 9:18936430-18936452 CAAGGTACTTGGGGGTGGGGAGG + Intronic
1052051046 9:23850237-23850259 CGGGGGTGCTGGGGGCGGGGGGG - Intergenic
1052728649 9:32260545-32260567 TAAGGCAGGTGGGGGCGGGGCGG - Intergenic
1053135359 9:35647235-35647257 GCAGGTAGCTGGGGATGCGGAGG - Intergenic
1053586505 9:39464364-39464386 CCAGGAACCTGGGGACGGGCGGG - Intergenic
1054579801 9:66900869-66900891 CCAGGAACCTGGGGACGGGCGGG + Intronic
1054927119 9:70600603-70600625 TCAGGAGGCTGGGGGTGGGGTGG + Intronic
1055805063 9:80083779-80083801 CCAGGGTGCTGGTGGCGGAGGGG + Intergenic
1057815334 9:98290072-98290094 CCTGGCAGCTGGGGGCCTGGTGG + Exonic
1058702330 9:107611538-107611560 ACAGGTTGCTGGGGTTGGGGAGG - Intergenic
1058773986 9:108266156-108266178 CCAGGTAGCTGGGAGGTGGCAGG - Intergenic
1060401313 9:123351075-123351097 TCAGTCAGGTGGGGGCGGGGTGG + Intergenic
1060402730 9:123357620-123357642 CATGGTGGCGGGGGGCGGGGTGG + Intronic
1060410966 9:123399963-123399985 CCAGTCAGCAGGGGGCGCGGTGG - Intronic
1060558352 9:124521858-124521880 CTAGGTAGCTGGGGGCCCCGAGG + Exonic
1060816413 9:126637827-126637849 ACAGAGAGCGGGGGGCGGGGGGG - Intronic
1060839327 9:126781719-126781741 CCAGGGAGCGGAGGTCGGGGAGG + Intergenic
1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG + Intronic
1061015449 9:127978594-127978616 CCAGGGGGCGGGGTGCGGGGTGG + Intronic
1061033411 9:128100330-128100352 CCTGGGAGGCGGGGGCGGGGGGG + Intronic
1061187574 9:129063628-129063650 GAAGGTAGCAGGGGGTGGGGTGG + Exonic
1061929791 9:133826635-133826657 CTAGGTGGCTGGGGGAGGGGTGG - Intronic
1062389422 9:136327986-136328008 CCGGGGGGCTGGAGGCGGGGTGG + Intronic
1062436185 9:136547554-136547576 CCTGGTGGGTGGGGGTGGGGTGG + Intergenic
1062469667 9:136696936-136696958 CCAGGGAGGAGGGGGAGGGGAGG - Intergenic
1062573269 9:137195136-137195158 GCAGGTAGCTGTGTGCAGGGAGG - Intronic
1062623593 9:137433424-137433446 CCAGGCAGGAGGGGGAGGGGTGG - Intronic
1062660330 9:137627822-137627844 CCAGCTACTTGGGGGTGGGGGGG - Intronic
1186190317 X:7061582-7061604 CCAGGCAGCGGGGGTGGGGGTGG - Intronic
1186989233 X:15049750-15049772 TCAGGTAGCTGGTGACAGGGAGG + Intergenic
1187425896 X:19176853-19176875 CCAGTGTGCTGGGGGTGGGGCGG - Intergenic
1188078648 X:25808629-25808651 CCATGGGGCTGGGGGAGGGGTGG + Intergenic
1188651115 X:32632717-32632739 CCAGGACGCTGGGTGCGGGGGGG + Intronic
1189207837 X:39257033-39257055 CCAGGTGGCTGGGGGAGGGGTGG - Intergenic
1189718623 X:43891356-43891378 TTAGGTAGTTGGGGGTGGGGCGG + Intergenic
1190133065 X:47768770-47768792 CCGGGCAGGTGGGGGTGGGGGGG - Intergenic
1190230895 X:48581057-48581079 CCCTGGATCTGGGGGCGGGGGGG + Intergenic
1190297126 X:49034244-49034266 ACAGGCAGCTGGGGGCAGAGAGG + Exonic
1190304613 X:49074905-49074927 GCAGATGGCTGGGGGAGGGGGGG + Exonic
1190431095 X:50378559-50378581 CCAGGTAGGCAGGGGCTGGGTGG - Exonic
1190957264 X:55207926-55207948 GCAGGGGGCGGGGGGCGGGGGGG + Intronic
1192196003 X:69028649-69028671 CTAGGTAACTGGGGGAAGGGGGG - Intergenic
1192787017 X:74345753-74345775 ACAGGTAGTTTGGGGGGGGGGGG - Intergenic
1192926596 X:75760347-75760369 CTAGGCAGCTGGGGGTGGTGGGG - Intergenic
1193781698 X:85710867-85710889 AAAGGTAGTTGGGGGCTGGGGGG + Intergenic
1193782605 X:85722220-85722242 TTAGGTGGCCGGGGGCGGGGGGG - Intergenic
1194268404 X:91781298-91781320 CCGGGTAGAAGGGGGAGGGGGGG + Intronic
1195598319 X:106718522-106718544 CCAATTAGCTGGGGGGTGGGGGG - Intronic
1195668423 X:107450123-107450145 CCCGGGAGCCGGGGGCAGGGCGG + Intergenic
1195732043 X:107977977-107977999 CAAGGTACCTGGGGTGGGGGTGG - Intergenic
1199673548 X:150166051-150166073 CCAGGTAGGTGGCGGGGTGGGGG + Intergenic
1199881264 X:151975338-151975360 CCAGGTATTTGGGGGCAGGGAGG + Intergenic
1200080851 X:153575634-153575656 CCACGGGGCTGGGGCCGGGGGGG + Intronic
1200585605 Y:5002211-5002233 CCGGGTAGAAGGGGGAGGGGGGG + Intronic