ID: 1015543799

View in Genome Browser
Species Human (GRCh38)
Location 6:134342302-134342324
Sequence CTCTCTGCACAGCTTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015543799_1015543808 20 Left 1015543799 6:134342302-134342324 CCAACCTCAAGCTGTGCAGAGAG No data
Right 1015543808 6:134342345-134342367 GTCGTAGCCTCCTGTCCCCAGGG No data
1015543799_1015543803 -4 Left 1015543799 6:134342302-134342324 CCAACCTCAAGCTGTGCAGAGAG No data
Right 1015543803 6:134342321-134342343 AGAGCCTGGGACTAGCCCAATGG No data
1015543799_1015543807 19 Left 1015543799 6:134342302-134342324 CCAACCTCAAGCTGTGCAGAGAG No data
Right 1015543807 6:134342344-134342366 TGTCGTAGCCTCCTGTCCCCAGG No data
1015543799_1015543809 21 Left 1015543799 6:134342302-134342324 CCAACCTCAAGCTGTGCAGAGAG No data
Right 1015543809 6:134342346-134342368 TCGTAGCCTCCTGTCCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015543799 Original CRISPR CTCTCTGCACAGCTTGAGGT TGG (reversed) Intergenic
No off target data available for this crispr