ID: 1015543809

View in Genome Browser
Species Human (GRCh38)
Location 6:134342346-134342368
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015543797_1015543809 29 Left 1015543797 6:134342294-134342316 CCAGAAACCCAACCTCAAGCTGT No data
Right 1015543809 6:134342346-134342368 TCGTAGCCTCCTGTCCCCAGGGG No data
1015543799_1015543809 21 Left 1015543799 6:134342302-134342324 CCAACCTCAAGCTGTGCAGAGAG No data
Right 1015543809 6:134342346-134342368 TCGTAGCCTCCTGTCCCCAGGGG No data
1015543804_1015543809 -2 Left 1015543804 6:134342325-134342347 CCTGGGACTAGCCCAATGGTGTC No data
Right 1015543809 6:134342346-134342368 TCGTAGCCTCCTGTCCCCAGGGG No data
1015543800_1015543809 17 Left 1015543800 6:134342306-134342328 CCTCAAGCTGTGCAGAGAGCCTG No data
Right 1015543809 6:134342346-134342368 TCGTAGCCTCCTGTCCCCAGGGG No data
1015543798_1015543809 22 Left 1015543798 6:134342301-134342323 CCCAACCTCAAGCTGTGCAGAGA No data
Right 1015543809 6:134342346-134342368 TCGTAGCCTCCTGTCCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015543809 Original CRISPR TCGTAGCCTCCTGTCCCCAG GGG Intergenic
No off target data available for this crispr