ID: 1015544611

View in Genome Browser
Species Human (GRCh38)
Location 6:134348619-134348641
Sequence TTGGAGAAAGGGCCTCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015544611_1015544616 -4 Left 1015544611 6:134348619-134348641 CCCTTCTGAGGCCCTTTCTCCAA No data
Right 1015544616 6:134348638-134348660 CCAATACATGCTGACAAAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015544611 Original CRISPR TTGGAGAAAGGGCCTCAGAA GGG (reversed) Intergenic
No off target data available for this crispr